Memorial Service for Donna Maureen (née McCullogh) Smith

30 November 2009

Memorial Service for Donna Maureen (née McCullogh) Smith

(26 September 1953, Montreal, Quebec, Canada – 27 November 2009, Tampa, Florida, USA)

Mother of Joel Smith

A Memorial Service for Maureen Smith will be held Saturday, December 5, 2009 at Berkeley Preparatory School, in Tampa, Florida.

9:00 a.m. – 10:45 a.m. – The Jean Ann Cone Library – Greeting Reception

11:00 a.m. – 12:00 noon – Lykes Center for the Arts – Memorial Service


Address – Berkeley Preparatory School, 4811 Kelly Road, Town n’ Country, Tampa, Florida 33615
Click here to continue reading...

My Tangent - Why Genealogy?

Afternoon,

Genealogy is sort of boring, isn’t it? I mean it’s not every day that you pick up a newspaper or magazine, or check out a website or blog just to get your genealogy fix… that is unless you are a part of a small percentage of this world's population. I suppose genealogy really has to turn you on in order to delve into the unchartered, (unchartered to you, that is), realms of your ancestors’ lives and into the places from where they came from. Genealogy has to turn you on that you really would prefer to following your passion to the dismissal of cooking, errands, work, reading, and anything thing else necessary for day-to-day-living.

I’m trying to think, today, exactly what it is that has me so obsessed with this genealogy thing. Why do I spend the majority, and I mean the majority of my waking, as well as should-be-sleeping hours affixed with finding the next bit of information of some past ancestor or some relative that I probably never met or even knew about? In that matter, probably some relative or long-past cousin I would never have had anything to do with. The powers-that-be do say that “you can pick your friends, but you can’t pick your relatives.”

Ask yourself, if you’re reading this, “Why do I want to know more about my family past?”

From About.com: Genealogy I found seven points published as to the most popular reasons one may research his or her family history. I thought I would answer each as it may pertain to me. (Obviously I can’t answer for anyone else…) Here goes:

  1. To satisfy your curiosity about yourself and your roots? No.
  2. To provide your children with a sense of who their ancestors were, where they came from and how they lived their lives? No.
  3. To preserve family cultural and ethnic traditions for future generations. No.
  4. To compile a medical family history to give family members an advantage in the battle against inherited diseases or defects? No.
  5. To qualify for a lineage or heritage society. No.
  6. To assemble and publish a family book, whether for family members or for profit. No.
  7. To discover facts that others have overlooked and solve the puzzle of a lifetime. No.

Well I failed that test. I didn’t blatantly start into genealogy and family history research for any of the above seven reasons. That’s not to say that today I continue to pursue my search efforts for all the above reasons. I am obsessed, point-blank. I can see myself realizing the benefits of all the reasons, and I’m sure many more.

In my past I detested English and History as subjects in schools. They were always scraping the bottom of my grade-levels. I was into Maths and Sciences, Arts and Languages. Then I got my first degree in English. This Genealogy has me reading of histories of areas, people, industries, occupations, politics, and so on. I’m writing continually. Genealogy may have had a positive influence.

And I’m now providing connections to family and friends the world over. And because of today’s technology and telecommunications I’m amazed at the locations that people are constantly checking in.

Maybe it’s my age now… Is there a magic age that triggers an interest in genealogy? Maybe it’s the coupling of today’s technology with the data and information of the past? Could be the thrill of the search and the joy of the find?

Well, now I now that my eyes don't cloud over when I hear the word "Genealogy"."

Enjoy,

Jim
Click here to continue reading...

Part 133b – Brunhammer Doherty Genealogy – 1837 Birth Jacques (Jacob) Brunhammer

29 November 2009


Afternoon,

DMC Mulhouse-Dornach 1874; Histoire de D.M.C.

Based on all the information that we have gathered to date, we can almost step out and state that we think that the genealogy of every Brunhammer and Brunhamer in the United States is linked to Jacques (aka Jacob) Brunhammer.

And as there appears to be no available documentary proof, we have deduced that gg-grandfather Jacques (aka Jacob) Brunhammer immigrated to the United States sometime during the last four months of 1875… We definitely know that the rest of the family, his wife, gg-grandmother Marie and six of his children arrived in Pennsylvania on the 17th of May 1876, as outlined in Part 92b.

GG-grandfather Jacques, using the name Jacob, became an American citizen in 1883. See Part 96b.

For more information of the Brunhammer Family, see Parts 93b and 95b. This is by no mean the totality of the Brunhammer ancestry and genealogy… it is only a beginning.

What of his earlier life? What of his birth and boyhood? Where exactly in France was he from?

As far as we can tell from the documentation and data that we have discovered, gg-grandfather Jacques Brunhammer was born the 22nd of October, 1837. We have been able to locate three sources of information.

The first is Le Table Décennales or the 10-Year Table. This was discovered on the microfilm FHL[732713], Registres de l’état civil, 1793-1882, Tables décennales - Naissances 1823-1853; Officier de l’état civil, Dornach (Mulhouse, Haut-Rhin).


Transcription -
Nom – Brunhammer
Prénom Naiʃsaience – Jacques
Dates du actes – 22 8eme 1837

My translation -
Name – Brunhammer
Birth name – Jacques
Date of Acts – 22 October 1837

In this case the month written as “8eme” is literally translated as the 8th. But the 8th month is October from the old Roman calendar, from the Latin “octo” meaning “eight”. It does not represent August, which in the majority of French documents is spelled out as “aout.”

The next page is the Index Page from the microfilm FHL[732717], Registres de l’état civil, 1793-1882, Tables décennales - Naissances 1823-1853 ; Officier de l’état civil, Dornach (Mulhouse, Haut-Rhin.)



Transcription –
Nombres Des Actes – 68
Dates des Actes Naiʃsances – 22 – 22 ‘’ (Octobre)
Noms et Prénoms Des Enfants – Brunhamer, Jacques
Nombre –
Garçon – 1
Fille –
Naturer de Naiʃsance – ‘’ (légitime)

My translation –
Number of Certificate – 68
Date of Birth Certificate – 22 – 22 ‘’ (October)
Surname and Name of the Children – Brunhamer, Jacques
Number –
Boy – 1
Girl –
Nature of Birth – ‘’ (legitimate
)
And from the Index I was able to locate the actual Acte de Naissance – Birth Certificate, or Registration, on the same microfilm FHL[732717]. The document is extremely hard to read. I have attempted a fair transcription. The enclosed image is pieced together from facing pages from the same Register.



My attempted Transcription -
68
Brunhamer
Jacques
L’an mil huit Cent trente-sept, le vingt-deux du mois d’octobre à dix heures du matin, par-devant nous soussigné ? Antoine Baur ?, premièr adjoint, remplissant par délégation du Maire en date du vingt –neuf Aout dernier les fonctions d’officier de l’État Civil de la commune de Dornach, canton du Mulhausen Département dans Haut Rien, est comparu Françoise _____ sage-femme âgé de vingt-trois ans demeurant _____ cette commune, la quelle _____ _____ _____ présenté un enfant du sex Masculine né hier le Vingt-deux de ce mois à deux heures après midi dans la maison du Chictant? Enz? _____ derrière du village en cette Commune, et _____ Joseph Brunhamer _____ _____ âgé de trente un ans et Catherine Ganzer son Épouse sans profession, âgé du vingt-huit ans, les conjoint domicilié en cette Commune _____ _____ _____ _____ ils ont déclaré vouloir donner le prenons du Jacques, les dites déclaration et présentation faites en présence d’Antoine _____ garde de _____ âgé de soixante ans, et Louis _____ _____ âgé du vingt-huit ans, les deux domiciliés en cette les _____ témoins _____ à la _____ _____ _____ _____ _____
et _____ _____ _____ _____ a déclaré _____ _____ _____ les _____ _____ _____ de Georges _____ les dites _____ _____ _____ _____ _____ _____ _____ _____ âgé de cinquante et cinq ans _____ _____ _____ âgé de soixante ans _____ _____ _____ _____ domiciliés _____ _____ _____ _____ ____ _____ _____ et les ______ _____ _____ _____ de _____ après qu’il _____ _____ _____ fait ______ et interprétation.
_____ _____ _____ Baur?

As there are a number of blanks in my transcription I have not attempted any translation. I would like to challenge any one reading this Post, especially Brunhammers, to attempt a chance at transcribing that which I seem not to be able to read. My visual acuity could change when I get my new glasses next week... Maybe?

I can extract the following from the actual Acte: Jacques Brunhamer was born the 22nd of October, 1837 in Dornach in the Canton of Mulhouse and Department of Haut Rhin. He was born to Joseph Brunhamer, who was 31 years old, and to Catherine Ganzer, his wife who was 28 years old. The registration of birth was presented by a midwife named Françoise, and I can’t make out her last name. From that point I am having a bit of difficulty trying to make out the remainder of information. Please send your thoughts and ideas by either commenting to this Posting or to me by email.

And of course, if you noticed on the Table Décennales, the 10-Year Table above, there are three more Brunhammers listed: Henri Laurent, Jean, and Catherine. Stay-tuned and find out if they are related.

Enjoy,

Jim
Click here to continue reading...

Part 132c - Smith Robertson Genealogy - Crossley Descendant Chart

Early Morning,

Couldn’t sleep tonight so I thought I would work on the first draft of the Crossley Descendant Chart. This is one of my ancestral lines in my genealogy that I have been able to uncover a great many generations. My earliest Crossley ancestor is my 8-times great-grandfather Anthony Crossley.

For some of us in our part of the family tree we could be his 10-times great-grandchild. From the records and history that I have been able to gather he was born in around the north-western part of England, in about Lancashire. I’ll provide some more documentation and possible evidence in future posts. He is alleged to have been born around 1655… and that’s about 354 years ago. Wow!

St Chad’s, Rochdale Photograph copyright: Alexander P Capp
Source: Geograph website and reproduced here in accordance with the terms of the site licence which can be viewed at this link
.


His wife was 8-times great-grandmother Martha (née Fielding) and they were purported to have been married at St. Chads, the Rochdale Parish Church, in the County of Lancaster about February 1679.

And here is the new Crossley Descendant Chart. This Chart is larger than normal, and may take more than one page to print.



Enjoy,

Jim
Click here to continue reading...

Part 131v – Smith Robertson Genealogy – 1828 Baptism Madelaine Ventour

28 November 2009

Evening,

Following my thoughts to research the genealogy of gg-grandaunts Sophia (née Smith) Ventour and Mary Ann (née Smith) Steele I am reviewing the information that I have captured on file. I have not been able to find each of their baptisms or birth registrations but I have located Marriage Entries for each.

GG-Grandaunt Sophia was married to Benjamin Ventour 16 September 1825 (see Part 62s). GG-Grandaunt Mary Ann was married to George Steele 15 December 1832, (see Part 62s).

Both gg-grandaunts Sophia and Mary Ann were mentioned in their father’s, ggg-grandfather James Smith’s Last Will and Testament dated 21 February 1843, Part 61s. Two references two each were:
and the further sum of Eight pounds annually to each of my daughters Sophia Ventour and Mary Steele during their natural lives...

to the several annuities of Eight pounds each bequeathed to my daughters Sophia Ventour and Mary Steele...


I have not as yet made an extensive search of the Ventour family, which of course I would conduct in order to find clues of my ggg-grandfather James Smith, the senior. To date I have been able to discover the Baptism Entry, from the microfilm FHL [1523656], Item 4 Parish Registers, 1784-1971, Anglican Church, Parish of St. George (Grenada), for 1st cousin 3 times removed Madelaine Ventour.


Sources: Parish of St. George, Anglican Church, Grenada 
and Family History Library


My transcription of the transcription, (see Part 128s) -
309

A.D. 1828

1757

Madelaine, daughter of Benjamin Ventour – Planter - & Sophia his wife, born on the 25th August 1826, was baptised at Fontenoy? Estate in the Parish of St. Georges the 29th of February 1828 by me.

Sgd. Willm D. Sealy, Officiating Minister

Sponsors:-
Madelaine Versepery, Mary Ann Smith, Matthew Welch.


I discovered a cross-reference to a Fontenoy Estate in St. George’s on Page 4 of the August 1824, Reference To The Plan Of The Island of Grenada by Gavin Smith published in London in 1882. Also inserted is the possible location of on the map/plan highlighting the possible location of the Fontenoy Estate where the baptism of 1st Cousin 3 times removed Madelaine may have occurred. (Thanks to Steve for sending me a copy of the Plan.)


 

Just a couple of points to think about. One the Sponsors listed on Madelaine Ventour's Baptism Entry is a "Mary Ann Smith". All-things-being-equal this may have been gg-grandaunt Sophia (née Smith) Ventour's sister and daughter of ggg-grandfather James Smith and Mary Ann Doret.

Enjoy,

Jim
Click here to continue reading...

D. Maureen (née McCullogh) Smith's Passing

It's with sad news that I write that Joel's Mother, Maureen passed away quietly yesterday afternoon, November 27.

Moe will be missed.

Jim


Click here to continue reading...

My Tangent – Genealogy Descendant Chart Administration

Today I'm spending some time catching up.

The first thing I've done is to try and figure out the listing of the Descendant Charts in the left-hand column. The Charts will now follow in this order. The word completed always means that a Chart will be a work in progress.

My 8 Ancestral Lines

Smith (completed) – Robertson (completed)

Scott (completed) – Abraham (to be completed) – July (completed)

Merrifield (completed) – Goodey (completed) – Crossley (to be completed)

Other Smith-Robertson relationships:

  • Marie July and St. Philippe
  • Marie July and Renier
  • Marie July and Abraham
  • Marie July and Siblings
  • Early Smith Baptisms
  • Gentle Births and Baptism

Andy's 8 Ancestral Lines

Brunhammer (completed) – Doherty (completed)

Walsh (completed) – McAteer (completed) – Pierce (completed)

Sheridan (completed) – Holmes (completed) – Gallagher (to be completed)

Other Brunhammer-Doherty relationships

All-things-being-equal I hope to add a third right-hand column that will be the housing for the Descendant Charts.

Enjoy,

Jim

Click here to continue reading...

Part 130s – Smith Robertson Genealogy – 1831, Which James Smith?

27 November 2009

Early Morning,

And I know above all, that the thought of developing a coherent strategy to research my genealogy and ancestors having the names “James” and “Smith” is certainly a mind-blowing task. A fixed search, that is, using quotations for example “James Smith”, produces only 300,000 results in Google. That’s only 300,000!

The new MS Bing search engine produces 158,000,000 for the same parameters. Yahoo yields 3,900,000 and AOL 134,000. Cuil drops the results to only 22,665 and Ask then increases the number of hits to 54,800,000.

According to the websites White Pages and ChaCha.com, and the 1990 US Census, “James Smith” is the 1st most common name in the United States.

On Facebook it is the 10th most common name used for public Facebook profiles… And like I always say, and they agree, John Smith is a great alias, but James Smith is a real name! Sorry Johns. And then my name is not Mohammed, the forename, Chang or Zhang, the surname… referring to the most common in the world.

If I increase the search parameters to “James Smith” adding the word “Grenada” the results reduce, expectedly. Ask – 1,590; Cuil – 141; AOL – 1,170; Yahoo – 18,200; Bing – 7,000; and Google – 13,600… And then the issue here is that the first couple of hits, of almost all of the above-mentioned search engines, are my own writings, inquiries, or Blog postings.

And when I ask “How many search engines exist on the Internet?” my mind is boggled when I check the list provided by Wikipedia.

In my work searching for any genealogical clues, I have chanced upon a conundrum that I am trying to understand.

Here are some of the details and the pieces of information I’ve gathered.

Family history provides that GG-Grandfather James Smith, Jr. was a Carpenter, a Master Carpenter, and an Architect.

Some of the documented records reflect that GG-Grandfather James Smith, Jr. held the same three positions and occupations. (See Parts 116s; 106s; 107s; 119s; and 102s.)

Also stated in documented records; GGG-Grandfather James Smith, the senior, may have been a Shipwright (See Part 60s.) A shipwright is a carpenter who helps build and launch wooden vessels.

In a copy of The Grenada Magazine: Or Monthly Miscellany Of Religious and General Information, No. I, January, 1833, Vol. I on page 33 there is an entry entitled “Parish Church of St. David – With An Etching”. The Etching is the above insertion, and the piece follows.



I am curious of the highlighted sentence on the 2nd page that states: “The Architects were Messrs. James Smith and James Horne.” All-things-being equal this could be a reference to my ancestor. The article refers to the fact that the Parish Church of St. David “was finished in July, 1831.

In a mention from The Grenada Handbook, Directory and Almanac For the Year 1897, compiled by Edward Drayton, Colonial Secretary and published in London in 1897, it states on page 42, inserted below, that “The foundation stone of St. Patrick’s Anglican church was laid on June 29, and shortly after those of the St. Andrew’s and St. David’s churches; while in September the erection of the Presbyterian kirk in St. George’s was commenced.



The question I next have, was it gg-grandfather James Smith, Jr. who was the Architect of these churches? Or was it ggg-grandfather James Smith, the senior? Or could there have been another Architect named James Smith?

GGG-Grandfather James Smith could have been the Architect. He may have passed away in 1842 and the first record that I have on file is dated 1812, the birth of his daughter, gg-grandaunt Eley. The completion date of the Church in St. David was July 1831.

GG-Grandfather James Smith is referred to as an Architect in the 1855 Baptism Entry of his son, g-granduncle Thomas. It is also inferred by the reference to his 1876 Obituary that he “was an architect by profession, he returned to his native country after a thorough training in England…” (See Part 102s.)

As gg-grandfather James, Junior was born in 1815, he would have been just 15 years old when the Churches’ foundation stones were laid and the erection of the Presbyterian kirk in St. George’s had begun. He would have been 16 years old in July 1831 when the Parish Church of St. David was completed. Was he not a wee bit too young to have been the Architect? And during what years did he receive his “thorough training” in England? My present day logic does not quite grasp the concept that he would have been a professional architect at that specific time. It does make present sense to me that ggg-grandfather James Smith or another gentleman by the same name may have been the Architect.

And I keep searching. Please let me know your thoughts. Do have any supporting or other documentation that would make a case pro or con?

Enjoy,

Jim

Click here to continue reading...

Part 129s – Smith Robertson Genealogy - 1802 The Times Article – Going Out On A Plank

26 November 2009

Early Morning and early Thanksgiving,

I found this article on a search of The Times of London, England dated 27 December 1802…



Sources: The Times, London England; 1788-1833 
and Ancestry.com, Historical Newspaper Collection

As the available Historical Newspaper Collection is offered for the years 1788 through 1833 I thought I may take a chance and see if I may find something about ggg-grandfather James Smith.
My criteria for a search were the following: James; Smith; Grenada; and Carpenter all together. (As a side note you need to know that an ordinary hit on an exact search for the name “James Smith” on Ancestry.com brings up 1,307,801 hits.)

Well you could imagine my surprise when I chanced upon this short 1802 article in The Times that contained all four words. The image copy is not that great and I definitely cannot venture at this time to state that this has anything at all to do with ggg-grandfather James Smith. As the saying goes, “Nothing ventured, nothing gained.” And who knows this may just be an errant piece in the “treasure map” to discovering something about him.

The following is the article that I snagged from the page –


And here’s my attempt at transcribing the article.
COURT OF COMMON PLEAS, DEC _4
SITTINGS BEFORE LORD _____ _____
LUNDERBERG _____ SMITH?

This action was _____ _____ ______ _____ _____ of the Plaintiff. _____ _____ _____ the _____ _____ _____.

The Plaintiff was a S____ S____, a_____ _____ a_____ __red to _____ with Captain Smith?, while _____ _____ _____ was lying at Laʃbow. He was _____ ______ _____ _____ during the voyage ______ _____ _____ _____ ______ _____ ______ and from thence home to _____ _____ _____. It appeared that he was much _____ ____ _____ was often intoxicated during the voyage, _____ _____ _____ to do his duty, _____ _____ _____ when _____ _____ go to Grenada, where the _____ _____ _____ to have ʃeveral Negroes, paying them _____ _____ a day to do his work. The Defendant?, not? Being? able to in-duce him to do his _____ _____ _____ _____ the ship’s cargo, procured a G_____ _____ the _____, and? continued him in a p_____ _____ _____ _____; after? which? he was taken on board again, and behaved very well during the remainder of the voyage.

James Smith was the _____ evidence to _____ the Plaintiff’s miʃconduct; he was brother to the Defendant, and Carpenter of the Veʃʃel. He pretended he had heard frequent diʃputes between the Captain and Lunderberg, though (by the bye, he was to deaf? that the queʃtions put to him were loudly _____ before he could understand them. The Mate of the ʃhip, who had ʃeen the Plantiff’s conduct, could not be brought forward, being out of England.

The Learned JUDGE did not _____ have sufficient? proof had appeared to warrant the ʃtoppage of the Plaintiff’s wages, the Jury thereto gave a verdict in his favour, deducting part? and his pay for the pay-ment of the Blacks that had been _____ to do his duty.


One note the symbol ʃ is called a long-s and should be translated as s. Therefore ʃhip could be translated to be ship, Veʃʃel as Vessel.

I am in no way saying that this article refers, in some way, to ggg-grandfather James Smith, but there are certainly a number of coincidences.

Any ideas?

Anyone who may have a chance at visiting the British Library in London certainly would be invited to see if they may obtain a better copy of the same article.

Enjoy,

Jim


Click here to continue reading...

Part 128s – Smith Robertson Genealogy – Early Baptisms 1786-1860, St. George, Grenada

24 November 2009

Afternoon,

The sun has not appeared as yet today, and it may not do that as the rain, lightning, and thundering has just started. I’ve got two Rat Terriers sitting in my lap, a Sheltie-mix at my feet, and two Yellow-Labs pacing. Taylor, the Chocolate Lab is the only one calm amidst the storm as she sleeps fast asleep on her bed. And you can image me reaching for my keyboard working on my genealogy.

I’ve been reviewing and graphically setting the birth information, as best as possible that I have been able to extract from the Parish of St. George, Grenada Baptismal Register. I am a visual person and at times I need to have that information which I am working with, especially in a surname search study, displayed graphically.

GenoPro is a very good software that allows me the ability to enter genealogical data and then to display my results on my screens. It allows me to manipulate the output at the same time permitting to provide as concise a view as I want to see.

My main sources of data are the Baptism/Christening Entries from the St. George Parish Register. I also decided that I would limit my time frame to as close to as possible to 1786 through 1860. This information is in the most cases St. George data.

This work, as always is a work in progress. There may be transcription inaccuracies as I read through the penned data and information. (I think the batteries in my electronic keyboard are beginning to give up.)

My source is the microfilm FHL [1523656], Items 1 through 8, Parish Registers, 1784-1971, Anglican Church, Parish of St. George (Grenada).

Items 2 and 4 are themselves transcriptions of the original Parish Register. I have enclosed a copy of the page with the Declarations by the Transcriber.


My transcription of the Declaration -
Declaration

I, John Randolph Bertrand of the Town of Saint George do solemnly declare that I have copies the following entries from the St. George’s Church Register dating from the year 1784 to the year 1804, and do unhesitantingly affirm that it is a faithful and true Copy of the Original.

And I make this solemn Declaration conscientiously believing the same to be true and by virtue of the provisions of the Oaths Ordinance 1897.
J.R. Bertrand

Declared to before me this 15th day of March 1903.
A Wellesley Lewis J.P.
and Chancellor W.J.D.

I, Wilfred Jones Bateman, Rector of the Town and Parish of Saint George, do solemnly declare that the following Entries from the St. George’s Church Register, dating from the year 1784 to the year 1840, are true copies of the Original Register, having been read over to me by the Copyist and corrected by me.
Wilfred Jones Bateman
Rector of S Georges

And I make this solemn Declaration conscientiously believing the same to be true and by virtue of the provisions of the Oaths Ordinance 1897.

Declared to before me this 15th day of March 1903.
A Wellesley Lewis J.P.
and Chancellor W.J.D.

And now I’m the transcriber transcribing the work of the transcriber who transcribed the original work and entries.

Here is my initial Smith Worksheet. In most cases I have attempted to use the birth date if it is included in the Baptism Entry. To follow a time sequence, the mini-descendant charts move from the left to the right; there is no downward flow. Each mini-descendant chart is unique and should stand alone. There may be inter-connections and relationships, but that is not part of this worksheet at this time. I have highlighted two names: James Smiths in blue, and William Smiths in red. My prime purpose is to visualize possibilities.

The Worksheet is a long page and may take more than a single sheet to print out.



I have images of all these Baptism Entries. Please let me know if you would like to see a copy of the image, which will be in a jpg format. Also, if you have any questions, or suggestions, please comment to this or any Posting, or email me.

Enjoy,

Jim

Click here to continue reading...

Part 127s - Smith Robertson Genealogy - New Scott Descendant Chart

23 November 2009

Morning,

Sort of an overcast day today... which of course does not mean too much down here in Tampa. The sun is always just around the next cloud, and we could always use the rain.

I'm trying to see if I can cut down on my electric bill this next month, which of course is a big joke since it is more or less the beginning of the holiday season. I just thought that as it had increased by 32% this past month I would have to take some drastic measures to curtail the use of my dependency on the power grid. This month I'm trying not to put on the air conditioning or the heating. That may sound funny to some of you up North, but that's the Florida winter norm... one day hot, next day cold.

As promised I've created another Descendant Chart. This time my Scott Family line. As mentioned great-grandmother Ella Margaret Louise (née Scott) Smith was my father's father's mother. See Parts 121s and 124s.

The inserted picture, thanks Zoë and Ray, is a small Smith family grouping including:

on the left great-grandmother Ella Margaret Louise (née Scott) and in the middle great-grandfather William James. Four of their seven children are pictured including grandfather Hubert Lloyd in the back; granduncle Sidney Hutson; and grandaunts Louise Clare and Olive Esme.

The new Scott Descendant Chart is as follows:



This past weekend, I made contact with "new" family members and descendants of ggg-grandparents James and Mary Ann (née Doret) Smith. Welcome Suzanne and Lorna. I certainly appreciated your new information as we piece together our world-wide Smith family tree.

And supper last night was a variation on the Okonomiyaki recipe; this time with scallops, zucchini, and Napa cabbage. It really is so easy to make... and enjoy.

Regards,

Jim.

Click here to continue reading...

Part 126s – Smith Robertson Genealogy – Bilney, Nassau – G-Grandmother Ella’s Birth Place

21 November 2009

Afternoon,

I implied a question in Part 121s regarding the birth location of great-grandmother Ella Margaret Louise (née Scott) Smith. The text on the Birth Announcement from September 12, 1857 publication of the Nassau Guardian is somewhat a bit difficult to transcribe. With Toni’s, Dave’s and Ray’s assistance, we can say that, all-things-being-equal; the birth location is “Bilney.”

I discovered the approximate location in a search from a book “Bahamas For Dummies”, 4th Edition, published by Wiley Publishing, Inc., 2007.

The red marker on the inserted Google map below, is the location of the area known as Bilney. It’s amazing how I’m learning how the histories of my ancestors cross with my short past. One never knows from what resources this whole genealogy trip will take them.



I’m now curious as to with which Anglican church in Nassau, great-grandmother Ella’s father, my gg-grandfather Alexander Scott was associated.

Stay-tuned…

Enjoy,

Jim
Click here to continue reading...

Part 125s – Smith Robertson Genealogy – The GG-Grandaunt Mary Ann (née Smith) Steele Search Begins – 1812 Baptism – GG-Granduncle George Steele

Morning...

The Steele-Smith search begins. I’m trying to determine what documents I have discovered which do relate to great-great-grandaunt Mary Ann (née Smith) Steele.

In Part 61s she is mentioned in ggg-grandfather James Smith’s Last Will and Testament (LWT). Per his LWT gg-grandaunt Mary Ann, along with gg-grandaunt Sophia were to each receive an annual sum of £8. There are other details to their inheritances outlined.

In Part 62s gg-grandaunt Mary Ann’s marriage to George Steele is presented via the Parish Register Marriage Entry. Her marriage occurred on the 15th of December four days after that of her parents in 1832. This December of 2009, that will be 177 years ago. My mind is trying to fathom that fact… 177 years.

I have not been able to come across a Baptism Entry for gg-grandaunt Mary Ann which of course could mean that she may be either one of gg-grandfather James, Jr.’s elder or younger sisters. On record, the oldest document I have on hand is the 1812 Baptism Entry for her sister gg-grandaunt Eley, (see Part 87s.) I also have her brothers’ Baptism Entries: gg-grandfather James, 1815– Part 88s; gg-granduncle Henry, 1818 – Part 89s; and gg-granduncle Thomas – 1820 – Part 90s. I have not been able to come across the same for gg-granduncle George or gg-grandaunt Sophia (née Smith) Ventour.

And so my methodology to find some clues is to begin a collateral research into the Grenada-based name of Steele, specifically of her husband gg-granduncle George Steele.

Immediate success, sort-of… The 1812 Baptism Entry in the Saint George Parish Register. George, Son of Richard Steele and Justine Bourbusson, born the 6th of October 1810. From the microfilm FHL [1523656] Item 1, Baptisms, Marriages and Burials 1806-1831, Parish Registers, 1784-1971, Anglican Church, Parish of St. George (Grenada), here’s the image of the page.


Sources: Parish of St. George, Anglican Church, Grenada 
and Family History Library


And for some reason my yellow highlighter won’t work on this image, so I will transcribe –
156
A.D. 1812
839
George Son of Richard Steele and Justine Bourbouʃon
Born 6th of October 1810, and baptised ?th of September
1812.

Francis McMahon
Sponsors.
Thomas Otway
Francis La Barrie?
Anne Garraway?


And I forge forward.

Enjoy,

Jim
Click here to continue reading...

Part 124s – Smith Robertson Genealogy – 1878 Marriage – G-Grandparents William James Smith and Ella Margaret Louise Scott

20 November 2009

Late afternoon,

And before I set off to the optometrist to have my annual eye checkup, which of course means my eyes will probably be a bit more blurry than they normally are when she puts in those drops that they then provide me with those wrap-around-my-head sunglass. Yes, that’s right, sunglass, or should I say sun-plastic. You know that thing that fits around your head… and then states to the world that I’m really blind, and I shouldn’t be out in the Florida sunshine.

Enough said about that, I thought I would follow up with the 1878 Marriage Entry to the Saint George Parish Register of the entry for my great-grandparents William James Smith and Ella Margaret Louise Scott. And this is on the heels of the posting, Part 121s regarding great-grandmother Ella’s 1857 birth and registration. Great-grandfather William James’ Baptism Entry can be found at Part 106s.

From the microfilm FHL [1523656], Item 13, Marriages 1844-1930, Parish Registers, 1784-1971, Anglican Church, Parish of St. George (Grenada) I was able to locate the Marriage Entry.


Sources: Parish of St. George, Anglican Church, Grenada 
and Family History Library

My highlighted transcription –
Page 116

MARRIAGES solemnized in the Parish of Saint George in the Colony of Grenada in the Year 1878

William James Smith, Bachelor of this Parish
Merchant
and Ella Margaret Louise Scott, Spinster of this Parish
were married in this Church by Banns with Consent of
this thirtieth day of April
in the Year One Thousand Eight-Hundred and Seventy Eight.

By me, Geo. A. Gentle, Officiating Minister, St. Patricks
This Marriage was solemnized between us { Wm. J. Smith
                                                                    { Ella Margaret Louise Scott

                                      In the presence of { E.W. Webster
                                                                   { J.E. Smith
No 325


Quite a bit of information is provided on this Marriage Entry. Great-grandparents William James Smith and Ella Margaret Louise (née Scott) were married by his brother-in-law the Reverend George Augustus Gentle who was married to his youngest sister, great-grandaunt Grace Eliza. (See my postings of May 5, May 9, and Part 118s.)

The second interesting fact is the signature of the second witness. It appears to me, as I have transcribed, as J.E. Smith. Could this be great-grandfather William James’ younger brother James Edwin Smith? It would make sense, but since I have the name James Smith, and it is the most common name in the English language, I can only offer this as food for thought. It was only today at the optometrist office that the clerk could not find my name in their database. It was only found under J.K. Smith.

Enjoy,

Jim
Click here to continue reading...

Part 123s – Smith Robertson Genealogy - Smith Descendant Chart Update 7

Afternoon,

Thought I would quickly put up the latest update of the Smith Descendant Chart. Per my tracking this should be Update 7.


Just a word of note… Any new additions to the Descendant Chart from previous updates should have the labels of the name and/or dates, and at times, the square or circle symbol, in red. The notations in red should be cross-referenced to postings in my Blog where information and/or data concerning an individual may be located. You can enter the “P121s” notation as “Part 121s” in the Search box in the upper-corner of the left-hand green column under the heading “Search This Blog”. And no, Toni I have not as yet figured out how to allow the reader to click on the red notation to link it directly from the image to the Blog posting… Maybe in time…

Enjoy,

Jim
Click here to continue reading...

Part 122b – Brunhammer Genealogy – Y-DNA Results Are Back

Afternoon,
This morning I thought I would follow up with just a few numbers to boggle your mind… actually 67 numbers. Andy’s Y-DNA test results are all back, and before you sit down and put all 67 numbers to memory, I thought I would try and present a bit of info to help clarify what this all may mean. I first introduced the topic of Brunhammer Y-DNA in Part 83b.

The first thing to know is that there are two chromosome tests that Andy has had done; the Y-DNA and the mtDNA tests. I going to begin discuss a bit of my understanding of the Y-DNA testing and results in this posting.

Andy is still waiting for the mtDNA results which should be back sometime in December. My sources of information are FamilyTreeDNA, WorldFamlies, C. F. Kerchner & Associates, and Genetree.

This Y-DNA Chromosome test only traces the MALE line, that is, only the male Brunhammer line. In this case, Andy from his father Eugene; from his grandfather Harry; from his great-grandfather Eugène; from his great-great-grandfather Jacques (aka Jacob); from his ggg-grandfather Joseph; from his gggg-grandfather Sébastien; from his ggggg-grandfather Conrad; from his gggggg-grandfather Conradus, and back… Per the information, it also means that all of Andy’s brothers and uncles should realize the same Y-DNA results.

But it doesn’t only stop there. This means that all of Andy’s brothers’ sons should have the same results. That is, John, Steve, Paul, John, Eric, Todd, and Brandon all exhibit the same Y-DNA results, all 67-marker results. Remember this is specific to the male Brunhammer line only. Y-DNA was not passed to any of his sisters, or aunts, or his sister’s sons.

And this means that every one of great-great-grandparents Jacques and Marie (aka Jacob and Mary)’s sons’ sons’ and grandsons, and so on all should carry the same Y-DNA. Also all of the Brunhammer, Bruhammer, Brunhamer, and Bruhamer sons who can trace their descendency from gggggg-grandfather Conradus Bruhamer should show the same.

From our most recent contacts these Y-DNA results should include: Eric, Juju, Mark, Nicolas, Norman, Phyllip, Tom, Walter, Alan, Pierre, Mathieu et al.

The actual Y-DNA results are –


These are all 67 markers. The DYS# is the Designated Y chromosome Segment. It is the name for the marker at a particular location, place, or locus. In Andy’s case all 67 markers at the 67 locations were tested. The Allele is a DNA sequence that repeats at a certain location on the Y chromosome. As the Allele number for DYS# 393 is 13, this means that the code at this location is repeated 13 times. And if the code is GATA, then the Allele value would be GATA and GATA and GATA, for a total of 13 times. It would look like – GATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATA. This is what is used to compare to other men’s DNA at this DYS# 393 location. All this being equal, all the male descendants of Conradus Bruhamer should all match at all 67 markers.

I’ll stop here for right now, so you can digest this. The Brunhammer Haplogroup has been predicted at I2a, I-P37.2 for short… but I’ll continue that at another posting shortly.

Enjoy,

Jim.

Click here to continue reading...

Part 121s – Smith Robertson Genealogy – 1857 Birth Great-Grandmother Ella Margaret Louise Scott

19 November 2009

Morning,

And today I thought I would quickly jump to another country… the Bahamas, for the registration of my great-grandmother Ella Margaret Louise (née Scott) Smith.

Did you know that “the water used at the christening of the Princess Beatrice, Queen Victoria’s youngest daughter, was brought from the river Jordan"?


 
Source: The Nassau Guardian and Bahamas Islands’ Advocate And Intelligencer, 
published the 9th of September 1857

The format of civil registration in the Bahamas for my great-grandmother Ella Margaret Louise’s birth seemed to mirror that of Grenada, which of course makes sense, as they were both a part of the British Empire at the time. I am just at odds trying to understand why the birth registrations were predominantly just a registration of a “human being” and not necessarily an individual. I’ve highlighted the line where I believe her birth, sans nom, is registered.



The above page of the Civil Registration was located on the microfilm FHL [222934] Births 1854-1857, Birth, marriage and death registers, 1850-1959, Registrar General, Bahamas.

My transcription –
BAHAMAS
BIRTHS IN THE Eastern District of the Island of New Providence DURING THE THREE MONTHS ENDING THE 30th DAY OF September 1857.
No. – 19
WHEN BORN. – 6th September
NAME, IF ANY. –
SEX. – F
NAME AND SURNAME OF FATHER. – Alexander Scott
NAME AND MAIDEN SURNAME OF MOTHER. – Sarah A.R. Scott formerly McKowen
RANK OR PROFESSION OF FATHER. – Episcopal Clergyman
WHEN REGISTERED. – 10th September
SIGNATURE OF REGISTRAR. – C.E. Spenser
BAPTISMAL NAME, ID ADDED AFTER REGISTRATION OF BIRTH. –

And then I went looking through WorldVitalRecords.com. I was able to find a database of scanned images of pages from the Nassau Guardian.

Using the birth and registration dates I thought that I would just check out some scanned pages near that time range. I lucked out. It was a “Eureka Moment!” I discovered a two line Birth Announcement that ties. It has to be the Birth Announcement for my great-grandmother Ella Margaret Louise Scott. And from the information that I have discovered to date, great-grandmother Ella Margaret Louise only had four brothers. I have not been able to find any data referencing any other female sibling. This may be her.


 
Sources: The Nassau Guardian, Nassau, Bahamas
and WorldVitalRecords.com


My transcription –
BIRTH – At Briney?, on the 6th instant, the wife of Revd. Alexander Scott, of a daughter.

Thanks Ray and Dave for your attempts at transcribing the place of birth “At Briney?”. I still not sure exactly what it is, but the Civil Registration above is titled “THE Eastern District of the Island of New Providence”. This would lead me to believe that “Bimini” is not the place, and which is not an actual physical location on New Providence. I just wonder if any of the other or out-islands were included in a “registration district” versus an actual location. If any one has any thoughts, insights, please feel free to comment or email me.

Enjoy,

Jim




Click here to continue reading...

Part 120s – Brunhammer Doherty Genealogy – Discovery - GGG-Grandmother Catherine Sheridan

17 November 2009

Afternoon,

Following up to my note in Part 116s regarding a search and the new Sheridan Descendant Chart in Part 112s I achieved success. I discovered the Sheridan Family listed on an 1870 and an 1880 US Census. The new updated Sheridan Descendant Chart follows.


The surname of Sheridan is presented in a number of ways listed on the 1870 and 1880 Censuses. The variations of spellings are: from 1870 – Sheradin; and from 1880 - Shearden; Sherdian; Sheardian; and Sheardia. Only two enumerators and five different spellings...

Check out the ages of gg-grandfather Thomas. He is listed at 32 years on the 1870 Census, and 10 years later on the 1880 Census he has only gained three years and is listed at 35 years. GG-grandmother Ellen on the other hand is 25 years old in 1870 but has aged 13 years to 38 years old on 1880 Census. There must be something in the water in Wilmington, especially between 1870 and 1880. Great-grandmother Mary (née Sheridan) Doherty and great-granduncle John do age the mandatory 10 years from Census to Census.

One-year old great-grandaunt Catherine, who was born circa July 1869, may not have lived past childhood as she is not enumerated in the 1880 Census. All-things-being-equal she may have been named for her grandmother, ggg-grandmother Catherine, who in 1870 is living with the family and may be a widow at 55 years old.

Two more; great-grandaunt Ellen, who may have been known as Nellie, and great-granduncle Dennis had been added to the family by the 1880 Census. Great-grandaunt Ellen was born about 1876 and great-granduncle was born about late 1877.

On the 1st of June in 1880, the Sheridan family lived at 8 Madison Street in Wilmington, in the County of New Castle, Delaware. GG-Grandfather Thomas (listed Shearden), who was a Boiler Maker, had been unemployed for the past 12 months. In the 115th Column the heading asks the following: Is the person (on the day of the enumerator’s visit) sick, or temporarily disabled, so as to be unable to attend to ordinary business or duties? If so, what is the sickness or disability? And I’m not sure I can make out or understand that which the enumerator wrote – “Diaspectie”.

Here are the highlighted pages of the 1870 and the 1880 Censuses.


Sources: Ninth Census of the United States, 1870. Washington, D.C.
National Archives and Records Administration; and Ancestry.com.




Sources: Tenth Census of the United States, 1870. Washington, D.C.
National Archives and Records Administration; and Ancestry.com.


Are the neighbors, at 10 Madison Street, Mary Kane, and John and Bridget Sheardian, in the 1880 Census, relatives?

And going to post I just discovered more family information on the 1900, 1910, and 1920 Censuses. Stay-tuned.

Feel free to comment or email me.

Enjoy,

Jim
Click here to continue reading...

Part 119s – Smith Genealogy – 1855 Baptism - Great-Granduncle Inkermann Samuel Thomas Smith

Early Morning,

The youngest son, on record, of gg-grandparents James, Jr. and Cecilia Jane (née Thomas) Smith was great-granduncle Inkermann Samuel Thomas Smith. His Baptism Entry in the Anglican Church Parish Register of the St. Luke’s District of the Parish of St. George is dated 25 March 1855.

Sources: Parish of St. George, Anglican Church, Grenada  and Family History Library


As you can see from the format of the page from the Register it is a bit different for the previous copies of the pages of the Baptism Entries of his brothers and sisters. The information requested is the same as the older version. You can also see from the copy of my image that the margin on the left-hand side has some writing but it has been obscured by either ink, dirt, or a rip in the page.

The page of the Baptism Entry was discovered on the microfilm FHL [1523656], on Item 8 which presents the Baptisms 1844-1892 of the Parish Registers, 1784-1971, Anglican Church, Parish of St. George (Grenada).

My transcription is -
Page 7

BAPTISMS solemnized in the Parish of St. George, (St. Luke’s District) in the Island of Grenada in the Year of Our Lord 18_____

When Baptized – 1855 Mar. 25, No. 51
Name & Age – Inkermann Samuel Thomas Son of
Parent’s Name
Christian, Surname – James & Cecilia Jane Smith
Abode – Good Hope
Quality Trade or Profession – Architect
By Whom the Ceremony was performed – S. Oliver Crosley, Curate.

My immediate question, “Why Inkermann?” Where did that name come from? And of course I went searching. And I found some answers, possible answers as to why gg-grandparents James and Cecilia named a son Inkermann. Given that great-granduncle Inkermann was baptised in 1855, they may be some connection of his name to the location of Mount Inkerman and the Battle of Inkerman, a victory in the Crimean War in 1854.

Just a thought... It's amazing what I'm learning.

Enjoy,

Jim
Click here to continue reading...

Part 118s – Smith Genealogy – 1852 Baptism - Great-Grandaunt Grace Eliza Smith

16 November 2009


Afternoon,

The next Baptism Entry found in my genealogy hunt is the one for great-grandaunt Grace Eliza Smith. The Entry could be dated July 1852, but I cannot make out the exact date due to the either a splotch of or the bleeding of the ink on the paper. The subsequent entry is dated 1852 Aug 27th, and I can make out the month of July in the two preceding her Entry. Her birth date, as written in the left-hand margin is also hard to read.

Great-grandaunt Grace Eliza (née Smith) Gentle was introduced back in one of my original postings of the Gentle Mystery on May 5.

The Gentle Mystery continued on May 9 and on May 15... with more on August 14. I am amazed at the amount of detail that I have at times been able to collect, and especially thanks to all who have contributed.

The source of this following image of the page of the Baptism Entry for great-grandaunt Grace Eliza is the microfilm FHL [1523656]and Item 8, Parish Registers, 1784-1971, Anglican Church, Parish of St. George (Grenada).


Sources: Parish of St. George, Anglican Church, Grenada 
and Family History Library

My best transcription –
Page 65

Baptism Solemnized in the Parish of Saint George in the Colony of Grenada in the Year of Our Lord 1852

When Baptized – 1852 _____ _____, No. 490
Name & Age – Grace Eliza daughter of
Parent’s Name
Christian, Surname – James & Cecilia Jane Smith
Abode – Parish of St. George
Quality Trade or Profession – Carpenter
By Whom the Ceremony was performed – J.A. Anton, Rector.
Born _____ _____ ____ J.A.A.


Any tries at the dates? Email me or comment on this posting with your ideas.

Enjoy,

Jim
Click here to continue reading...

Part 117s – Smith Genealogy – 1850 Baptism - Great-Grandaunt Rosanne Maria Smith

15 November 2009

Afternoon again,

I’ve got a dog in my lap with hiccups as I’m at the keyboard working on the family tree and genealogy. When she, Bella, arrived at our doorstep she was a dainty little thing. Now the pack mentality has most definitely taken a part of her life. She no longer broods over her bowl of her food. It’s gone in two or three gulps… and then she weaves herself through the legs of the larger dogs hoping that she can pick up a stray morsel or bit that has fallen between bowl, mouth, and floor. She’s fearless. In the morning when I let her out, she bolts down to the end of the picket fence, squeezes through and bounds after the teasing squirrels. And she always comes back. Bella’s a packet of energy.

Insert: Girls, The boardwalk – Tinker, back; Taylor, towering; and Bella, as always, front.

Found another Smith Baptism Entry in my genealogy research, this time great-grandaunt Rosanne Maria Smith. The date of the baptism is 20 November 1850. I can make out the written birth date, in the left hand margin of the page as the 10th of October 1849. This image is a page found on the microfilm FHL [1523656], Item 8, Parish Registers, 1784-1971, Anglican Church, Parish of St. George (Grenada). Question – Do you think the Smith family was a member of the Church of England? At least to the year 1850, and in Grenada?


Sources: Parish of St. George, Anglican Church, Grenada 
and Family History Library

My transcription -
Page 57

Baptism Solemnized in the Parish of Saint George in the Colony of Grenada in the Year of Our Lord 1850

Born Oct 10, 1849 J.A.A.
When Baptized – 1850 Nov. 20th, No. 435
Name & Age – Rosanne (could be Rosanna) Maria daughter of
Parent’s Name
Christian, Surname – James & Cecilia Jane Smith
Abode – Parish of St. George
Quality Trade or Profession – Carpenter
By Whom the Ceremony was performed – J.A. Anton, Rector.

Just a note: When you compare the various Baptism Entries from the same generations make sure to note that there are some incidental, albeit maybe major, differences.

If you have any questions or comments or information that may be helpful to the research please email me.

Enjoy,

Jim

Click here to continue reading...

Part 116s – Smith Genealogy – 1848 Baptism - Great-Granduncle Victor Smith

Afternoon,

Blog administration completed… Sunday mornings. And the email comments are coming in. Thanks Helen, for the Sheridan family tip. We’ll see what turns up later today when I start my Internet ancestry search. Hopefully today I can work on reducing at least one of the genealogical mountains of paper.

This afternoon the first ancestor and family tree posting is the Baptism Entry for great-granduncle Victor Smith. I located the following page on the FHL [1526356] microfilm. The page is included in Item 8 of the microfilm.

For your edification, Items on the FHL microfilms can be likened to chapters in a book, or to divisions. A microfilm can have one or many Items. Usually it is a sequence in the filming of a document, or a series of documents, books, related or unrelated, and that are included in a FHL microfilm. As you can see at the image of the summary of FHL [1523656] at the section of page titled “Film Notes” there is only in total, one microfilm number – FHL INTL Film [1523656]. But there are many Item numbers, from 1 through and including 20. This is a facilitation that assists with a search of images on the film. In this case the filmed image of the page for the Baptism Entry for great-granduncle Victor Smith should be found on the microfilm at Item 8, and it does.

The microfilm FHL [1523656], Item 8 is Baptisms 1844-1892 of the microfilm that includes the Parish registers of 1784 through 1971 of the Anglican Church, of the Parish of St. George in Grenada. With corresponding technology I have made a jpg copy of the image, and with the use of certain software I have attempted to trim the external parts of the film background of the page, sharpen the legibility, and reduce the bleed-through from the back-page, and tweak the image so that I can get a reasonable facsimile. With other software I have highlighted the actual entry for quick reference.


Sources: Parish of St. George, Anglican Church, Grenada 
and Family History Library

My transcription -
Page 44

Baptism Solemnized in the Parish of Saint George in the Colony of Grenada in the Year of Our Lord 1848

Born 24 Jany /48 JAA
When Baptized – 1848 October 1st, No. 338
Name & Age – Victor Son of
Parent's Name
Christian, Surname – James & Cecilia Smith
Abode – St. Leonard, Parish of St. George
Quality Trade or Profession – Carpenter
By Whom the Ceremony was performed – J.A. Anton, Rector.

If you have any questions or comments or information that may be helpful to the research please email me.

Enjoy,

Jim
Click here to continue reading...

Part 115s – Smith Genealogy – 1846 Baptism - Great-Grandaunt Eley Mary Smith

14 November 2009


Afternoon,

And the beat goes on. I had to switch, just to focus myself and work with something that I had found. Chasing genealogical documents in my research at times can take hours on end, and then its supper time. And you’ll notice that there is no Part 114… I created two; Part 106s and a Part 106w; earlier on. I do get confused from time to time, but I’m trying. This is Part 115s.

My focus at this moment is the 1846 Baptism Entry for great-grandaunt Eley Mary Smith, sister to my great-grandfather William James Smith, (see Part 106s). It always amazes me as to the repetition and use of names in a family. This time “Eley” and “Mary”.

Based on family notes and constructed records, I have learned to date that great-grandaunt Eley Mary Smith was the third of seven children of my great-great-grandparents James, Jr., and Cecilia Jane (née Thomas) Smith. The seven were great-grandfather William James; great-granduncles James Edwin, Victor Robert, and Inkerman Samuel Thomas; and great-grandaunts Eley Mary, Rosanne Maria, and Grace Eliza. Based on documentary evidence I have been able to substantiate six of the seven, not including great-granduncle James Edwin. I have also presented the possibility of an elder daughter of gg-grandfather James Smith and Amelia Charles, great-grandaunt Mary Smith in Part 105s.

This image of the page including the Baptism Entry, No. 240, from great-grandaunt Eley Mary Smith was discovered on the microfilm FHL[1523656], Item 8, Parish Registers, 1784-1971, Anglican Church. Parish of St. George (Grenada).


Sources: Parish of St. George, Anglican Church, Grenada 
and Family History Library


My transcription of the highlighted -
Page 31

Baptism Solemnized in the Parish of Saint George in the Colony of Grenada in the Year of Our Lord 1846

When Baptized – 1846 October 13th, No. 240
Name & Age – Eley Mary Daughter of, born April 5th, 1846.
Parents Name
Christian, Surname – James and Cecilia Jane } Smith
Abode – St. Leonard, Parish of St. George
Quality Trade or Profession – Carpenter
By Whom the Ceremony was performed – A.J.P. Buchanan?, _____ Minister of Carricou.

If you have any questions or comments or information that may be helpful to the research please email me.

Enjoy,

Jim


Click here to continue reading...

 

Share It

Please Note: All information and data... and work found on this blogsite and website is available for your use. Please do not be a "scab" and steal this information without acknowledgement of source. Also pleased be advised that there could be Copyright issues and legal yada...yadada...das... so be prewarned...

A Genealogy Hunt Copyright © 2009, 2010, 2011 - WoodMag is Designed by Ipietoon for Free Blogger Template