Part 731h – Brunhammer Doherty Genealogy – 1897 Baptism Grandmother Hannah Myrtle Holmes – Tamaqua, Schuylkill, Pennsylvania

Good Day,

The search and research into the genealogy of a family line never stops… and if one is addicted to the exploration and investigation, as I am, I am always looking for that next piece of critical and priceless documentation.

Today I have decided to follow Andy’s grandmother Hannah Myrtle (née Holmes) Doherty’s genealogy and Family Line. I immediately discovered her 1897 Baptism Registration as recorded at the Calvary Episcopal Church in Tamaqua, Schuylkill, Pennsylvania. The inserted image to the left is that of Calvary Episcopal Church.

Here is the image of the 1897 Baptism Registrations as downloaded from the Historical Society of Pennsylvania, Historic Pennsylvania Church and Two Records, Reel: 505, database as found on Ancestry.com. It is image 87 of 162.

My transcription –

2/3
Baptisms.

DATE – 1897 April 24
PLACE – Home
CHRISTIAN NAME – Hannah Myrtle
SURNAME – Holmes
DATE OF BIRTH –
PARENTS –
SPOINSORS – The Parents
MINISTER – F.C. Lauderburn

Even though, according to the Baptisms Register grandmother Hannah Myrtle was baptized at “Home” the family church appears to have been the Calvary Episcopal Church in Tamaqua. Just wait to see what I have found.

Enjoy,

Jim

Click here to continue reading...

Part 601b - Brunhammer Genealogy - Y-DNA Haplogroup I2a2* - DYS565=9

Good Day,

Just received a note regarding Andy’s Y-DNA results. As I receive information and data of DNA, I am sometimes at a loss at grasping what all the numbers mean. It sometimes is well and good when I receive the information in layman’s English... something that I can understand.

The Brunhammer Y-DNA testing has been completed with Family Tree DNA for the 111 markers. The DNA Y-Chromosome Segment (DYS): is a naming system which assigns DYS numbers to newly discovered markers. They are the "names" of each marker.

According to Family Tree DNA the Y-chromosome DNA (Y-DNA) haplogroups are the major branches on the human paternal family tree. Each haplogroup has many subbranches. These are subclades. Haplogroups and their subclades (branches) mark human migrations. Learning about haplogroups can tell one about their ancestors’ history and travels. The Brunhammer Haplogroup is 12a2*.

The note that I received is that the Marker Number 67 or DYS565 has some critical information. The information is pertaining to whether Andy’s Brunhammer Marker Number 67, DYS565 is either to 9 or to 11. Andy’s Brunhammer DYS565 equals 9. This means that the Brunhammer Y-DNA can be denoted to be Dinaric. It is NOT Disles. The information that we received:

This group is closely related to the much larger Dinaric group. The easiest way to distinguish the groups is with the last marker of FTDNA's 67: Dinaric has the very distinctive DYS565=9, while Disles has DYS565=11 like the rest of I2a. We say that Dinaric is "young" because all Dinarics have 67 marker values similar to each other. Disles have 67 marker values that show a wider range of variation. What we call Disles might be two or more groups: one very closely related to Dinaric, others more distant.

And of course, I went searching for some meaning, and from Wikipedia I discovered the following regarding the term “Dinaric”.

...According to the Dinaric model, Dinarics were to be found in the mountainous areas of the western Balkans: Croatia, Serbia, Montenegro, Bosnia and Herzegovina, Albania,Slovenia, Austria, part of northwestern Bulgaria, and northwestern Republic of Macedonia). Northern and Eastern Italy was considered mostly a Dinaric area as well as western Greece, Romania, western Ukraine, southeastern German-speaking areas, and parts of southern Poland and southeastern France...

and

...The vertical height of the cranium is high. Eyes are set relatively close and the surrounding tissue defines them as wide open. The iris is most often brown, with a significant percentage of light pigmentation in the Dinaric population. The nose is large, narrow and convex. The face is long and orthognathic, with a prominent chin, and also wide. The form of the forehead is variable, but not rarely it is bulbous. The haircolor is usually dark brown, with black-haired and blond individuals in minority, blondness being the characteristic of the more Central European, morphologically similar Noric race (a race intermediate between Nordic and Dinaric races). The skin is lacking the rosy color characteristic for Northern Europe as well as the relatively brunet pigmentation characteristic for the southernmost Europe and on a geographical plane it is of medium pigmentation and often it is variable...

Definitely an interesting discussion... and all this from one little 9 marker on the Brunhammer DNA code.

The above inserted map is J. Deniker's 1899 Races of Europe map.

And I continue to search... and research.

Enjoy,

Jim

Click here to continue reading...

Part 558b – Brunhammer Genealogy – GG-Grandmother Mary Brunhammer’s Final Resting Place Found!

Good Morning,

Great news! Thank you Diane in Pennsylvania.

Great-Great-Grandmother Mary (née Marie Katz) Brunhammer’s final resting place has been found. There is always a thrill of success in the field of genealogy when that object, or that piece of information, that has been evading you forever so long, finally turns up.

GG-Grandmother Mary (née Marie Katz) Brunhammer’s final resting place and grave site appears to be located at Arlington Cemetery at 2900 State Road, Drexel Hill, Pennsylvania. She is located in the Silverbrook Section of the Cemetery. GG-Grandmother Mary passed away on 11 December 1922 and was buried 14 December. The red marker in the following Google map represents the approximate location of gg-grandmother Mary's grave site.

Here is the Obituary from the Monday, December 14, 1922 edition of The Philadelphia Inquirer.

And my transcription –

THE PHILADELPHIA INQUIRER, THURSDAY MORNING, DECEMBER 14, 1922

OBITUARY

BRUNHAMMER. – Dec. 11. MARY, wife of late Jacob Brunhammer, aged 82. Relatives and friends invited to attend funeral. Thurs., 8.30 A. M., residence 1679 N. 56th St. High requiem mass at St. Gregory’s Church, 10 A. M. Int. private.

GG-Grandmother Mary arrived in the United States at Philadelphia on 17 May 1876 with six of her children. (See Part 92b.) Obviously, gg-grandfather Jacques was there to meet them. Together they had, according to our discovered sources 14 children. And from what we have learned is that there are many descendants, including all Brunhammers and Brunhamers now living in the United States.

We are so pleased with the most recent discovery. Our thanks also go to Tony and Cindy Lloyd of Nebraska who submitted the information to Find A Grave.

Another key piece of the Brunhammer vast and interesting history and genealogy is now in the record. We look forward to seeing photographs and images of gg-grandmother Mary’s final resting place. And we keep searching for the same of gg-grandfather Jacques (also known as Jacob) Brunhammer’s burial location.

We keep searching. Thank you, Diane.

Enjoy,

Jim

Click here to continue reading...

Part 475 – Brunhammer Doherty Genealogy – New YDNA and mtDNA Ascendancy Chart

Afternoon,

Updating my records and the information that I have on file, I have created a Brunhammer YDNA and mtDNA Ascendancy Chart. The Chart ends, (that is, at the bottom of the Chart), with Andy Brunhammer. As you can see his YDNA and mtDNA Haplogroups are I2a2 and X2e1a1, respectively.

If you are a male Brunhammer or Brunhamer and are descended from J (Jacques) Brunhammer and M (Marie) née Katz, the original Brunhammer immigrants to United States, who arrived at Philadelphia in 1875 and 1876, respectively, your Haplogroup coding and results should be the same; I2a2.

Based on the theory and the genetic results all male Bruhammers, Brunhammers, and Brunhammers descended from Joannes Conradus Bruhammer, who was born about 1704, should all have the same or near to the same YDNA result. Joannes Conradus Bruhammer was Andy’s 6-times great-grandfather. That also is a total of nine generations.

Based on the rarity of the Haplogroup coding, we have discovered that there is a possibility that 6-times great-grandfather Joannes Conradus Bruhammer, or at least his previous ancestors may have been from Dalmatia. Today Dalmatia is mostly in Croatia, with some parts in Bosnia, Herzegovina, and Montenegro. (See Wikipedia.)

Andy’s mtDNA Haplogroup, which he received from his maternal Doherty line, is X2e1a1. All of Andy’s brothers and sisters should have the same mtDNA results. This mtDNA information is passed to all their daughters and sons, but it is only the daughters who pass it on. He received his mtDNA from his mother Myrtle Francis Gertrude (née Doherty) Brunhammer who received hers from her mother Myrtle H. (née Holmes) Doherty. This continues back from mother to daughter to daughter, and in this case back, based on our records, to Hannah (née Gallagher) Holmes.

Tracing back this information from the Haplogroup, it is possible that Andy’s maternal lineage may have come, at some point in time, from Altai in Southern Siberia. Today the Altai Republic is a part of Russia. (See Wikipedia.)

All testing has been done by Family Tree DNA. If you have any questions or comments please feel free.

Enjoy,

Jim

Click here to continue reading...

Part 324b – Brunhammer Genealogy – New Confirmed Haplogroup – I2a2 - Dalmatia?

Afternoon,


Some new Brunhammer YDNA results are back. It has been confirmed that Andy’s Haplogroup has been progressed from I2a to I2a2. Following up from my Postings of Part 122b, Part 85b, and Part 83b, Brunhammers are I2a2 – Shorthand I-M423 from I2a – Shorthand I-P37.2.

And what does this mean?

I2a2 (M423) is typical of populations of south-eastern Europe. The highest population, a factor greater than 50% are in Dalmatia (Croatia) and Bosnia-Herzegovina. The Haplogroup I2a2 is also commonly found in other Slavic people, Romanians, Moldovans, Hungarians, Albanians, Greeks, and northeastern Italians. It would appear that Andy’s gggggg-grandfather Joannes Conradus Bruhammer’s ancestors may have originated from this area of Europe.

Would you believe that there is a Facebook Group named Haplogroup I2a2? Only 12 members but then again there are only a very small number of I2a2 participants in the Family Tree DNA database. Who knows, there could be a common ancestor in the Brunhammer line.

If you have any questions, comments, or ideas please drop a line.

Enjoy,

Jim

------------------

Bonne journée

Quelques nouveaux résultats de l'Brunhammer ADN-Y sont de retour. Il a été confirmé, que l'haplogroupe d'Andy, a été avancé de I2a à I2a2. Vous pouvez suivre de mon Commentaires de la partie 122b, la partie 85b, et de la partie 83b, Brunhammers sont maintenant I2a2 - I-M423 de I2a - I-P37.2.

Et qu'est-ce que cela signifie? I2a2 (M423) est typique des populations du sud-est de l'Europe.La population la plus élevée, un facteur supérieur à 50% sont en Dalmatie (Croatie) et la Bosnie-Herzégovine. Le I2a2 haplogroupe est également souvent dans les autres personnes de Slaves, les Roumains, Moldaves, des Hongrois, des Albanais, Grecs, Italiens et nord-est. Il semblerait que les ancêtres des ancêtres de l'arrière-arrière-arrière-arrière-arrière-arrière-grand-père Joannes Conradus Bruhammer de Andy peut provenir de cette région de l'Europe.

Croiriez-vous qu'il existe un groupe Facebook nommé Haplogroupe I2a2? Il n'y a que 12 membres mais là encore il ya seulement un très petit nombre de participants dans la base de données I2a2 Family Tree DNA. Qui sait, il pourrait y avoir un ancêtre commun dans la ligne Brunhammer.

Si vous avez des questions, commentaires ou idées s'il vous plaît envoyez une ligne.

Bon chance,

Jim

Click here to continue reading...

Part 161b - Brunhammer Doherty Genealogy - An Updated Brunhammer Descendant Chart

Early morning,

Now I can go to bed. I have been working on an updated Brunhammer Descendant Chart. If you examine this Chart you will see a number of new descendants, or vice versa, ancestors. It is far from finished but it certainly much further along than I expected to get at this point in time. Everyone that has been added to or changed from the previous Descendant Chart is in red. There are 36 individual additions and changes.

And this is most definitely not the end. This is a project in progress. The majority of new information has been gathered from US Censuses, from the following states: California, Delaware, Massachusetts, New Jersey, and Pennsylvania. I also decided to limit myself to only four spellings of the surname; Bruhamer, Bruhammer, Brunhamer and Brunhammer. There are a lot more as I mentioned in Part 146b and I have found more, but in most cases the others can be read as either a misspelling or a transcription error.

Because the Chart has grown so large and in order to present it without forcing you to go blind, I have been able to display it in three parts. If you click on anyone of the parts you should be able to view an enlarged image. Also, I believe that you should be able to print all three individual parts and they should fit together with some ease.

And here are the three parts -

As always, I have attempted not to include any person who is currently living, with the exception of Andy, and this is for the sake of privacy.

Please feel free to get in touch with me if you have any additions and questions.

Enjoy,

Jim

Click here to continue reading...

Part 146b – Brunhammer Doherty Genealogy – How Do You Spell Brunhammer?

Afternoon,

I'm now wearing new glasses...

Last night I discovered a couple more variations on the spelling of the surname Brunhammer. I found two unique transcriptions: "Brunleansen" and "Brunhamse" transcribed from the 1930 and 1920 US Censuses, respectively. These I located on Ancestry.com when I followed a search with a wild card “*”; that is, I keyed in the combination “Brun*”, with no first name. I also limited my search to Gloucester City, in Camden County, New Jersey.

The results were only 79 hits and included a "Thomas A Brunleansen", from the 1930 Census, and "Thomas Brunhamse", from the 1920. Both are the same person, based on the information provided in each Census. And the actual entries, regardless of how they were transcribed for Ancestry.com, the enumerators, from my eyes, entered: 1920 – “Brunhamer, Thomas”; and 1930 – “Brunhamer, Thomas A.”

Moving out of a fixed location search, and cross-checking with the 1910 Census from Philadelphia, Pennsylvania, Thomas’ surname is entered as “Brunhammer”. And here’s a wrench, and not necessarily a bad one; an alternative spelling for the 1910 surname is given as “Brunhemer”.

The 1900 Census of the South side of the Center of 8th Street, in Chester in the County of Delaware in Pennsylvania presents a unique researcher’s challenge. This time the enumerator appears, by my eyes, to have entered “Bernhemmer”. The transcriber entered the name as “Bernkenner” to Ancestry.com. Amazing…

And of course the burned up 1890 Census is no longer with us. But I was able to find an 1885 New Jersey State Census taken of the City of Gloucester in Camden County which includes the “Brunhammer” family plus Thomas. I discovered this page from a microfilm FHL [888604].

In 1883, the document of citizenship indicates that the surname is Brunhammer. See Part 96b. But gg-grandfather Jacob (aka Jacques) Brunhammer signed the document with his “X” mark. If he was illiterate, that could mean that he himself did not have an immediate idea of how to physically spell his surname. It appears that his witness, William C. Guy is the one who penned the “Brunhammer”.

Now the most puzzling of all spellings, or should I state “visual interpretation” is that of the 1880 Census. The penmanship of the enumerator is very good, in my opinion… and his written capital “B” looks like a capital “B”. And due to the fact that I am optically used to seeing the surname as Brunhammer, I can see the name written as “Brunhammer”. It may look a bit like “Brunharness”, but here’s the rub, accordingly, the clerk who transcribed surnames from the 1880 US Census to the Soundex Index Cards, eyeballed the name as “Preenharness”. It then appears that “Preenharness” was then transcribed and entered in the Ancestry.com database as such.

And then the 1876 Amérique Passenger Manifest lists the surname as “Bruhammer”, see Parts 92b and 138b. Just a note, of “eureka-ness”… for the lack of a better term; the 1920 and 1930 US Censuses list great-granduncle Thomas’ son as Camille. This now cross-references to the 1876 Passenger Manifest where there listed a 5-year old Camille who, all-things-being-equal, has to be the same person as Thomas. His name must have been Anglicized.

My discussion in Part 133b presents two distinctive writings of the surname: “Brunhammer” on the Table Décennales, the 10-Year Table; and what looks like “Brunhamer” in the 1837 Civil Registration of gg-grandfather Jacques’ birth.

And so to date, within this limited scope of study, I have discovered the surname written, transcribed and interpreted in a number of ways. This list is not all conclusive as I am extracting the surnames from only a few referenced documents applicable to gg-grandfather Jacques (aka Jacob) and his son, great-granduncle Thomas (aka Camille).

The spellings are -

1837 – Brunhamer
1842 – Brunhammer
1876 – Bruhammer
1880 – Brunhammer, Brunharness, Preenharness
1883 – Brunhammer
1885 – Brunhammer
1900 – Bernhemmer, Bernkemmer
1910 – Brunhammer, Brunhemer
1920 – Brunhamer, Brunhamse
1930 – Brunhamer, Brunleasen

Have fun with this one,

Jim
----------------------
Partie 146B - Brunhammer Doherty -- Comment épeler, Brunhammer?

Bonjour,

La nuit dernière, j'ai découvert, un couple plus de variations sur l'orthographe du nom de famille Brunhammer. J'ai trouvé deux transcriptions unique: «Brunleansen» et «Brunhamse», transcrits à partir des recensements des États-Unis des années 1930 et 1920, respectivement. Je les trouve sur Ancestry.com, lorsque j'ai suivi une recherche, avec une wild card, «*» ; qui est, je saisi à la combinaison «Brun*», sans prénom. J'ai aussi limité ma recherche à Gloucester City, dans le comté de Camden, New Jersey.

Les résultats ont été seulement 79 coups sûrs, et comprenait un «Thomas A Brunleansen», à partir du recensement de 1930, et «Thomas Brunhamse», à partir du 1920. Les deux sont la même personne, sur la base des informations fournies dans chaque recensement. Et les entrées elles-mêmes, indépendamment de la façon dont elles ont été transcrites pour Ancestry.com, les agents recenseurs, de mes yeux, est entré: 1920 - «Brunhamer, Thomas», et 1930 - «Brunhamer, Thomas A».

Déménagement d'une recherche de lieu fixe, et le recoupement avec les années 1910 Recensement de Philadelphie, en Pennsylvanie, le nom de Thomas est entré comme «Brunhammer». Et voici une clé, et pas nécessairement un mauvais; une orthographe de remplacement pour le nom de famille 1910 est considéré comme une «Brunhemer».

Le recensement de 1900 du côté Sud du Centre de la 8e Rue, à Chester, dans le comté de Delaware en Pennsylvanie, présente un défi unique pour ce chercheur. Cette fois, le recenseur paraît, par mes yeux, d'avoir saisi «Bernhemmer». Le transcripteur entré le nom de «Bernkenner» à Ancestry.com. Étonnante ...

Et bien sûr, le brûlé recensement de 1890, n'est plus avec nous. Mais j'ai été capable de trouver un État du New Jersey, Recensement de 1885, prise de la ville de Gloucester, dans le comté de Camden, qui comprend la famille des «Brunhammer» plus Thomas. J'ai découvert cette page à partir d'un microfilm FHL [888604].

En 1883, le document de citoyenneté indique que le nom de famille est Brunhammer. Voir la partie 96b. Mais gg-grand-père Jacob (Jacques) Brunhammer signé le document avec son "X». Si il était illettré, cela peut signifier que lui-même n'a pas eu l'idée immédiate, de l'orthographe physiquement son nom de famille. Il semble que son témoin, William C. Guy est celui qui a écrit le «Brunhammer».

Maintenant, le plus énigmatique de tous les orthographes, ou devrais-je dire «l'interprétation visuelle», est celle du recensement de 1880. La calligraphie de l'agent recenseur est très bonne, à mon avis ... et sa capitale écrite «B» ressemble à un capital «B». Et au fait, que je suis optiquement l'habitude de voir le nom de famille comme Brunhammer, je peux voir le nom écrit comme «Brunhammer». Elle mai ressembler un peu «Brunharness», mais voici la différence, en conséquence du greffier, qui transcrit à partir des noms de famille de recensement des États-Unis 1880 à nos fiches des Soundex, vu le nom de «Preenharness». Il apparaît alors que «Preenharness» a ensuite été transcrites, et est entré dans la base de Ancestry.com, en tant que telle.

Et puis le manifeste de passagers de 1876, du navire Amérique, ne mentionne le nom de famille comme «Bruhammer», voir les parties 92b et 138b. Juste une remarque, d'Eureka ... pour l'absence d'un meilleur terme, les 1920 et 1930 US recensements liste Camille, le fils du grand-grand-oncle Thomas. Ce maintenant traverser les références, au manifeste de passagers de 1876, où il a énuméré un à 5 ans, Camille, qui doit être la même personne que Thomas. Son nom doit avoir été faite en anglais.

Mon exposé dans la partie 133b, présente deux écrits distinctif du nom de famille: «Brunhammer» Tables décennales, et ce qui ressemble à «Brunhamer»" dans l'état civil de 1837 de la naissance du arrière- arrière-grand-père Jacques.

Et si à ce jour, dans ce cadre limité de l'étude, j'ai découvert le nom de famille écrit, transcrit, et interprété, dans un certain nombre de façons. Cette liste n'est pas concluante, car je suis l'extraction des noms de famille, à partir de seulement quelques documents référencés, applicable à l’arrière-arrière-grand-père Jacques (Jacob) et son fils, arrière-grand-oncle Thomas (Camille).

Les orthographes sont –

1837 – Brunhamer
1842 – Brunhammer
1876 – Bruhammer
1880 – Brunhammer, Brunharness, Preenharness
1883 – Brunhammer
1885 – Brunhammer
1900 – Bernhemmer, Bernkemmer
1910 – Brunhammer, Brunhemer
1920 – Brunhamer, Brunhamse
1930 – Brunhamer, Brunleasen

Amusez-vous avec celui-ci,

Jim

Click here to continue reading...

Part 136b – Brunhammer Doherty Genealogy – 1841 Birth – GGGranduncle Henry Laurent Brunhammer

Evening,

I’m on a roll right now. I’ve located the Table, Index, and Acte de Naissance for gg-granduncle Henry Laurent Brunhammer. He is the fourth child of ggg-grandparents Joseph and Catherine (née Ganzer) Brunhammer. One major thing to note is the way the name is entered into the documents; not the surname but the forename. It is entered as both “Henry” and “Henri”. This is a new bit of learning for me… I always thought “Henry” with a “y” was the Anglicized version of the French “Henri” with an “i”. The issue is not what the name is entered in on the Registration Entry or the Acte de Naissance, but that all three entries; the Table, the Index; and the Acte were entered, I would presume by a Francophone.

The Table Décennales; the 10-Year Table’s entry reads – as transcribed:

Nom – Brunhammer
Prénom Naiʃsaience – Henri Laurent
Dates du actes – 15 Juillet 1841

Translation –

Name – Brunhammer
Birth name – Henri Laurent
Date of Acts – 15 July 1841

My source was the Registres de l’état civil, 1793-1882, Officier de l’état civil, Dornach (Mulhouse, Haut-Rhin), microfilm FHL [732713].

The Index for summarizing the births for that year, 1841, found on microfilm FHL [732717] of the Registres de l’état civil, 1793-1882, Officier de l’état civil, Dornach (Mulhouse, Haut-Rhin) follows. You’ll notice that there has been a change in the 1841 Index. The names of the parents are not included as they were in the 1835 and 1835 Indexes. The names were also not included in the 1837 Index.

My transcription –

No. des Actes – 76
Noms et Prénoms – Brunhammer Henry Laurent
Date des actes – 15 Juillet
Garçon – 1
Fille –
Nature de la naissance – ‘’ (légitime)

And my translation –

No. of Certificate – 76
Surnames and Names – Brunhammer Henry Laurent
Date of Certificates – 15 Juillet
Boy – 1
Girl –
Nature of the birth – ‘’ (legitimate)

And of course, I found the actual Acte de Naissance, the Birth entry to the 1841 Register. My source was the Registres de l’état civil, 1793-1882, Officier de l’état civil, Dornach (Mulhouse, Haut-Rhin), microfilm FHL [732717].

And here I go with the transcription –

76
Brunhammer
Henry Laurent
Le 15 Juillet 1841
L’an mil huit cent quarante-un le quinze du mois de Juillet à huit heures du soir par-devant nous soussigné Antoine Baur, premier adjoint, remplissant par délégation de Maire en date du vingt-neuf Aout mil huit trente-sept les fonctions d’officier de l’état civil de la commune de Dornach, canton de Mulhausen Département de Haut Rhin, est comparu : Joseph Brunhammer, contre-maître, âgé de trente-cinq ans, domicilié en cette commune lequel nous a présente un enfant du sexe masculin qu’il déclare être né ci jourd’hui á sept heures du matin dans la maison du sieur Ofhiêbant Entz, _____ ______ ______ en cette commune, de lui déclarant et de Catherine Ganzer, sans état âgée de trente-trois ans et auquel il a déclaré vouloir donner les prénoms de Henry Laurent. Les quelles présentation et déclaration faites en présence de Nicòlas Ganzer, graveur sur bois, âgé de vingt-quatre ans, et Louis Ignace Diehly, instituteur agé de vingt-un ans, les deux domiciliés en cette commune, les quels témoins ont été _____ par le père de l’enfant et ont le père et les témoins signé avec nous le presentante de naissance après lecture et interprétation.
Brunhammer Ganzer _____ Baur

My attempt at translating –

76
Brunhammer
Henry Laurent
15 July 1841
In the year 1841, the 15th of the month of July at 8:00 o’clock in the evening, before us the undersigned Antoine Bauer, First Deputy, filling in for the Mayor by delegation dated the 29th of August, 1837, as officer of the civil state of the town of Dornach, in the Canton of Mulhouse, Department of Haut Rhin, appeared Joseph Brunhammer, foreman, 35 years old, residing in this city who presented to us a male child born today at 7:00 o’clock this morning in the house of Mr. _____ _____, _____ _____ _____ in this city, declaring him, and of Catherine Ganzer, stateless, 33 years old, and which he said he wanted to give the names of Henry Laurent. The presentation and what statement made in the presence of Nicolas Ganzer, wood engraver, twenty-four, and Louis Ignace Diehly, teacher, 21 years old, both domiciled in this city, and that the witnesses were _____ by the father of the child, and the father and witnesses signed with us the presentation of birth after reading and interpretation.
Brunhammer Ganzer _____ Baur

Three observations –

1. This time the ggg-grandfather Joseph signed his name Brunhammer with two “ms”.
2. Nicholas Ganzer could possibly be related to ggg-grandmother Catherine Ganzer, and
3. GGG-Grandfather Joseph’s occupation is legible to read “contre-maitre” which by definition and translation is that of “foreman”. Foreman of what? That’s next to find out.

If you have any comments or questions please feel to do so at any time.

Enjoy,

Jim

Click here to continue reading...

Part 122b – Brunhammer Genealogy – Y-DNA Results Are Back

Afternoon,
This morning I thought I would follow up with just a few numbers to boggle your mind… actually 67 numbers. Andy’s Y-DNA test results are all back, and before you sit down and put all 67 numbers to memory, I thought I would try and present a bit of info to help clarify what this all may mean. I first introduced the topic of Brunhammer Y-DNA in Part 83b.

The first thing to know is that there are two chromosome tests that Andy has had done; the Y-DNA and the mtDNA tests. I going to begin discuss a bit of my understanding of the Y-DNA testing and results in this posting.

Andy is still waiting for the mtDNA results which should be back sometime in December. My sources of information are FamilyTreeDNA, WorldFamlies, C. F. Kerchner & Associates, and Genetree.

This Y-DNA Chromosome test only traces the MALE line, that is, only the male Brunhammer line. In this case, Andy from his father Eugene; from his grandfather Harry; from his great-grandfather Eugène; from his great-great-grandfather Jacques (aka Jacob); from his ggg-grandfather Joseph; from his gggg-grandfather Sébastien; from his ggggg-grandfather Conrad; from his gggggg-grandfather Conradus, and back… Per the information, it also means that all of Andy’s brothers and uncles should realize the same Y-DNA results.

But it doesn’t only stop there. This means that all of Andy’s brothers’ sons should have the same results. That is, John, Steve, Paul, John, Eric, Todd, and Brandon all exhibit the same Y-DNA results, all 67-marker results. Remember this is specific to the male Brunhammer line only. Y-DNA was not passed to any of his sisters, or aunts, or his sister’s sons.

And this means that every one of great-great-grandparents Jacques and Marie (aka Jacob and Mary)’s sons’ sons’ and grandsons, and so on all should carry the same Y-DNA. Also all of the Brunhammer, Bruhammer, Brunhamer, and Bruhamer sons who can trace their descendency from gggggg-grandfather Conradus Bruhamer should show the same.

From our most recent contacts these Y-DNA results should include: Eric, Juju, Mark, Nicolas, Norman, Phyllip, Tom, Walter, Alan, Pierre, Mathieu et al.

The actual Y-DNA results are –

These are all 67 markers. The DYS# is the Designated Y chromosome Segment. It is the name for the marker at a particular location, place, or locus. In Andy’s case all 67 markers at the 67 locations were tested. The Allele is a DNA sequence that repeats at a certain location on the Y chromosome. As the Allele number for DYS# 393 is 13, this means that the code at this location is repeated 13 times. And if the code is GATA, then the Allele value would be GATA and GATA and GATA, for a total of 13 times. It would look like – GATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATA. This is what is used to compare to other men’s DNA at this DYS# 393 location. All this being equal, all the male descendants of Conradus Bruhamer should all match at all 67 markers.

I’ll stop here for right now, so you can digest this. The Brunhammer Haplogroup has been predicted at I2a, I-P37.2 for short… but I’ll continue that at another posting shortly.

Enjoy,

Jim.

Click here to continue reading...

Part 93b – Spotlights and Brunhammer Descendant Chart I

Last night when I was walking, actually I was hobbling, the dogs, Bella started barking at the night sky. She sometimes barks at birds and planes, as they fly overhead. I’m not really sure what’s in her mind at times, but I think she thinks that she can actually catch something. Well it was dark, and she kept barking. That’s when I saw them. Not birds. Not a plane… but four white circles, skipping around in the evening sky. It was the tracing of some spotlights. Spotlights from the high school a couple of miles away… and a prom or dance I think; it was about midnight. Crazy dog… Ferocious 11-pound canine, chasing spotlights.

Well I began working on a Brunhammer Descendant Chart in GenoPro. It’s one of the genealogy softwares that I use, and it is software that allows me a bit more freedom of a visual perspective and less of a mechanical constriction. I use a number of other genealogical programs dependent upon the types of attributes and features that I want to highlight and work with. When you pick or are looking for a program, think about what it is that you would like to accomplish. There are many ones now available, and if you need any assistance please feel free to get in touch with me.

In this case, and as there are many generations of Brunhammers, and I really do not want to compel you to go blind, I am creating two Brunhammer Descendant Charts. Brunhammer Descendant Chart – I begins with great-great-great grandfather Joseph Brunhammer and flows down to Andy. Please note that I will NOT be providing any information on these charts, or in this Blog, about any living person. Andy’s name, by his permission, will be the only name that may appear simply as a point and person of reference.

The yellow and blue symbols represent Andy's direct blood line. All information on this Descendant Chart is based on current and available information. It may change as new and more correct data is discovered. New and updated data may be entered in red.

Key - The added letters and numbers to the right of a name in the Descendant Chart, for example, I-P92b, can be used to locate an image of the document as it appears in the Blog - http://jklsmith.blogspot.com; B = Birth; C = Baptism/Christening; M = Marriage; D = Death or Burial; W = Will; I = Item of Interest; 85b = Part 85b. The small letter “b” represents a surname; in this example b = Brunhammer.

Please know that these descendant charts are always a work in progress. Additions, changes, corrections, upgrades, etc., may be made from time to time. If you have any question or comment please feel free to email me.

The next descendant chart, Brunhammer Descendant Chart II will continue back in time, by generations from ggg-grandfather Joseph Brunhammer. It is currently under construction. Stay tuned.

Enjoy,

Jim

Click here to continue reading...

Part 92b – Brunhammer Genealogy – A New Start

Good After Midnight,

As a number of you know, an initial part of my forage into genealogy; research and data collection were my first efforts with the Brunhammer Family. My reasoning at the time… the Brunhammers presented a stable, location-centric family. I being an immigrant and citizen, I thought that it would be "easier" to learn of an American family and their genealogy as I was living in the United States. It meant to me that I would have American resources at my finger tips, so-to-speak. I also thought that it may be easier to search after a unique surname, Brunhammer, versus my most common one, Smith.

Well that idea lasted back until 1875 and 1876, when the first Brunhammers, the Brunhammer line that I had decided to research, landed at Philadelphia. And that's the beginning of the story… the short version.

Mrs. Marie Bruhammer, (great-great-grandmother Mary Brunhammer), arrived in the United States and disembarked at the Port of Philadelphia on the 17^th of May 1876. Great-great-grandfather Jacques, (also known as Jacob) had to have been there to meet his family when they got off the steamship Amérique, (inserted above), after sailing across the Atlantic Ocean. All things-being equal they, Mama Marie and her six children boarded the Amérique at Le Havre after having traveled approximately 733 kilometers or about 460 miles across France from near Mulhouse.

Traveling in steerage with great-great-grandmother Marie were Charles – 12, Eugène - 7, Jules - 6, Jacques - 5, Marie – 2, and Camille - 1. As the years pass in the United States their names would be Americanized to Mary, Charles, Eugene, Geies then Julius, Jacob, Mary, and Thomas. Great-great-grandfather Jacques also becomes known, at times, as Jacob. The voyage began in Le Havre and proceeded across the English Channel to Plymouth, England and then across the Atlantic possibly to New York and then on to Philadelphia.

In our search we have not been able to find any migration information as yet for great-great-grandfather Jacques, but subsequent documentation confirms that he was most definitely in the United States, in Pennsylvania and New Jersey. As his family arrived in Philadelphia in May of 1876, we searched all passenger manifests hoping to find his arrival at a prior date. But the search has been to no avail, especially in light of the fact that we have not been able to find the records and manifests for the last four months of 1875. A trip to the National Archives in Philadelphia confirmed to us that the records for those four months are missing. And so a dead end… but he did come to the United States, and we have documented proof that he did live here.

The following are the introduction page and page listing the Bruhammers from the 1876 Steamship Amérique passenger manifest.

Sources: Passenger Lists of Vessels Arriving at Philadelphia, Pennsylvania, 1800-1882. 
Micropublication M425. RG036. Roll # 425_94. 
National Archives, Washington, D.C., and

Ancestry.com, Philadelphia Passenger Lists, 
1800-1945 [database on-line]. Provo, UT, USA.

My transcription of the 1^st image –

____delphia….

Name of Vessel, Steamship "Amérique".
Nation of Vessel, France..
Name of Master, A. Pouzolz..
Port Sailed from, Havre & Plymouth..
Number of Aliens, 176..
Number of Citizens, 88..
Consignees, Louis de Bébian..
Owners, General Transatlantic Company of Paris.

And my transcription of the 2^nd image –

No. – 244, 245, 246, 247, 248, 249, 250
NAME OF PASSENGER. – Mrs. Bruhammer Marie, -d.- Charles, -d- Eugéne, -d- Jules, -d- Jacques, -d- Marie, -d- Camille
AGE. – 33, 12, 7, 6, 5, 2, 1
COUNTRY OF BIRTH. – Alsace, d, d, d, d, d, d
LAST LEGAL RESIDENCE. – Alsace, d, d, d, d, d, d
COUNTRY CLAIMING ALLEGIANCE – Alsace, d, d, d, d, d, d
OCCUPATION AND REMARKS. –
- no, no, no, n

The "d" or similar mark represents "ditto". Notice also how "Alsace" is designated as a "Country". And of course, this means some more research...

And this begins my research and search of the Brunhammer Genealogy. Feel free to comment or email me. Also feel free to subscribe to my Blog and receive current notifications of postings.

Enjoy,

Jim

Click here to continue reading...