Part 122b – Brunhammer Genealogy – Y-DNA Results Are Back

Afternoon,
This morning I thought I would follow up with just a few numbers to boggle your mind… actually 67 numbers. Andy’s Y-DNA test results are all back, and before you sit down and put all 67 numbers to memory, I thought I would try and present a bit of info to help clarify what this all may mean. I first introduced the topic of Brunhammer Y-DNA in Part 83b.

The first thing to know is that there are two chromosome tests that Andy has had done; the Y-DNA and the mtDNA tests. I going to begin discuss a bit of my understanding of the Y-DNA testing and results in this posting.

Andy is still waiting for the mtDNA results which should be back sometime in December. My sources of information are FamilyTreeDNA, WorldFamlies, C. F. Kerchner & Associates, and Genetree.

This Y-DNA Chromosome test only traces the MALE line, that is, only the male Brunhammer line. In this case, Andy from his father Eugene; from his grandfather Harry; from his great-grandfather Eugène; from his great-great-grandfather Jacques (aka Jacob); from his ggg-grandfather Joseph; from his gggg-grandfather Sébastien; from his ggggg-grandfather Conrad; from his gggggg-grandfather Conradus, and back… Per the information, it also means that all of Andy’s brothers and uncles should realize the same Y-DNA results.

But it doesn’t only stop there. This means that all of Andy’s brothers’ sons should have the same results. That is, John, Steve, Paul, John, Eric, Todd, and Brandon all exhibit the same Y-DNA results, all 67-marker results. Remember this is specific to the male Brunhammer line only. Y-DNA was not passed to any of his sisters, or aunts, or his sister’s sons.

And this means that every one of great-great-grandparents Jacques and Marie (aka Jacob and Mary)’s sons’ sons’ and grandsons, and so on all should carry the same Y-DNA. Also all of the Brunhammer, Bruhammer, Brunhamer, and Bruhamer sons who can trace their descendency from gggggg-grandfather Conradus Bruhamer should show the same.

From our most recent contacts these Y-DNA results should include: Eric, Juju, Mark, Nicolas, Norman, Phyllip, Tom, Walter, Alan, Pierre, Mathieu et al.

The actual Y-DNA results are –

These are all 67 markers. The DYS# is the Designated Y chromosome Segment. It is the name for the marker at a particular location, place, or locus. In Andy’s case all 67 markers at the 67 locations were tested. The Allele is a DNA sequence that repeats at a certain location on the Y chromosome. As the Allele number for DYS# 393 is 13, this means that the code at this location is repeated 13 times. And if the code is GATA, then the Allele value would be GATA and GATA and GATA, for a total of 13 times. It would look like – GATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATA. This is what is used to compare to other men’s DNA at this DYS# 393 location. All this being equal, all the male descendants of Conradus Bruhamer should all match at all 67 markers.

I’ll stop here for right now, so you can digest this. The Brunhammer Haplogroup has been predicted at I2a, I-P37.2 for short… but I’ll continue that at another posting shortly.

Enjoy,

Jim.