Part 601b - Brunhammer Genealogy - Y-DNA Haplogroup I2a2* - DYS565=9

Good Day,

Just received a note regarding Andy’s Y-DNA results. As I receive information and data of DNA, I am sometimes at a loss at grasping what all the numbers mean. It sometimes is well and good when I receive the information in layman’s English... something that I can understand.

The Brunhammer Y-DNA testing has been completed with Family Tree DNA for the 111 markers. The DNA Y-Chromosome Segment (DYS): is a naming system which assigns DYS numbers to newly discovered markers. They are the "names" of each marker.

According to Family Tree DNA the Y-chromosome DNA (Y-DNA) haplogroups are the major branches on the human paternal family tree. Each haplogroup has many subbranches. These are subclades. Haplogroups and their subclades (branches) mark human migrations. Learning about haplogroups can tell one about their ancestors’ history and travels. The Brunhammer Haplogroup is 12a2*.

The note that I received is that the Marker Number 67 or DYS565 has some critical information. The information is pertaining to whether Andy’s Brunhammer Marker Number 67, DYS565 is either to 9 or to 11. Andy’s Brunhammer DYS565 equals 9. This means that the Brunhammer Y-DNA can be denoted to be Dinaric. It is NOT Disles. The information that we received:

This group is closely related to the much larger Dinaric group. The easiest way to distinguish the groups is with the last marker of FTDNA's 67: Dinaric has the very distinctive DYS565=9, while Disles has DYS565=11 like the rest of I2a. We say that Dinaric is "young" because all Dinarics have 67 marker values similar to each other. Disles have 67 marker values that show a wider range of variation. What we call Disles might be two or more groups: one very closely related to Dinaric, others more distant.

And of course, I went searching for some meaning, and from Wikipedia I discovered the following regarding the term “Dinaric”.

...According to the Dinaric model, Dinarics were to be found in the mountainous areas of the western Balkans: Croatia, Serbia, Montenegro, Bosnia and Herzegovina, Albania,Slovenia, Austria, part of northwestern Bulgaria, and northwestern Republic of Macedonia). Northern and Eastern Italy was considered mostly a Dinaric area as well as western Greece, Romania, western Ukraine, southeastern German-speaking areas, and parts of southern Poland and southeastern France...

and

...The vertical height of the cranium is high. Eyes are set relatively close and the surrounding tissue defines them as wide open. The iris is most often brown, with a significant percentage of light pigmentation in the Dinaric population. The nose is large, narrow and convex. The face is long and orthognathic, with a prominent chin, and also wide. The form of the forehead is variable, but not rarely it is bulbous. The haircolor is usually dark brown, with black-haired and blond individuals in minority, blondness being the characteristic of the more Central European, morphologically similar Noric race (a race intermediate between Nordic and Dinaric races). The skin is lacking the rosy color characteristic for Northern Europe as well as the relatively brunet pigmentation characteristic for the southernmost Europe and on a geographical plane it is of medium pigmentation and often it is variable...

Definitely an interesting discussion... and all this from one little 9 marker on the Brunhammer DNA code.

The above inserted map is J. Deniker's 1899 Races of Europe map.

And I continue to search... and research.

Enjoy,

Jim

Click here to continue reading...

Part 558b – Brunhammer Genealogy – GG-Grandmother Mary Brunhammer’s Final Resting Place Found!

Good Morning,

Great news! Thank you Diane in Pennsylvania.

Great-Great-Grandmother Mary (née Marie Katz) Brunhammer’s final resting place has been found. There is always a thrill of success in the field of genealogy when that object, or that piece of information, that has been evading you forever so long, finally turns up.

GG-Grandmother Mary (née Marie Katz) Brunhammer’s final resting place and grave site appears to be located at Arlington Cemetery at 2900 State Road, Drexel Hill, Pennsylvania. She is located in the Silverbrook Section of the Cemetery. GG-Grandmother Mary passed away on 11 December 1922 and was buried 14 December. The red marker in the following Google map represents the approximate location of gg-grandmother Mary's grave site.

Here is the Obituary from the Monday, December 14, 1922 edition of The Philadelphia Inquirer.

And my transcription –

THE PHILADELPHIA INQUIRER, THURSDAY MORNING, DECEMBER 14, 1922

OBITUARY

BRUNHAMMER. – Dec. 11. MARY, wife of late Jacob Brunhammer, aged 82. Relatives and friends invited to attend funeral. Thurs., 8.30 A. M., residence 1679 N. 56th St. High requiem mass at St. Gregory’s Church, 10 A. M. Int. private.

GG-Grandmother Mary arrived in the United States at Philadelphia on 17 May 1876 with six of her children. (See Part 92b.) Obviously, gg-grandfather Jacques was there to meet them. Together they had, according to our discovered sources 14 children. And from what we have learned is that there are many descendants, including all Brunhammers and Brunhamers now living in the United States.

We are so pleased with the most recent discovery. Our thanks also go to Tony and Cindy Lloyd of Nebraska who submitted the information to Find A Grave.

Another key piece of the Brunhammer vast and interesting history and genealogy is now in the record. We look forward to seeing photographs and images of gg-grandmother Mary’s final resting place. And we keep searching for the same of gg-grandfather Jacques (also known as Jacob) Brunhammer’s burial location.

We keep searching. Thank you, Diane.

Enjoy,

Jim

Click here to continue reading...

Part 161b - Brunhammer Doherty Genealogy - An Updated Brunhammer Descendant Chart

Early morning,

Now I can go to bed. I have been working on an updated Brunhammer Descendant Chart. If you examine this Chart you will see a number of new descendants, or vice versa, ancestors. It is far from finished but it certainly much further along than I expected to get at this point in time. Everyone that has been added to or changed from the previous Descendant Chart is in red. There are 36 individual additions and changes.

And this is most definitely not the end. This is a project in progress. The majority of new information has been gathered from US Censuses, from the following states: California, Delaware, Massachusetts, New Jersey, and Pennsylvania. I also decided to limit myself to only four spellings of the surname; Bruhamer, Bruhammer, Brunhamer and Brunhammer. There are a lot more as I mentioned in Part 146b and I have found more, but in most cases the others can be read as either a misspelling or a transcription error.

Because the Chart has grown so large and in order to present it without forcing you to go blind, I have been able to display it in three parts. If you click on anyone of the parts you should be able to view an enlarged image. Also, I believe that you should be able to print all three individual parts and they should fit together with some ease.

And here are the three parts -

As always, I have attempted not to include any person who is currently living, with the exception of Andy, and this is for the sake of privacy.

Please feel free to get in touch with me if you have any additions and questions.

Enjoy,

Jim

Click here to continue reading...

Part 159b – Brunhammer Doherty Genealogy – 1869-1930 Great-Grandfather Eugène Brunhammer

Afternoon,

The presents are wrapped, but I forgot the labels. And true to form I wrapped all the presents in the same type of paper. It's a grab-bag Christmas.

Written in Part 92b, 7-year old great-grandfather Eugène Brunhammer accompanied his mother, great-great-grandmother Marie and his four brothers and sister across the Atlantic Ocean aboard the Amérique. He was born in Dornach, a small town on the outskirts of Mulhouse, which today is, I believe considered a suburb of Mulhouse. Mulhouse is in the Alsace region of France almost at the French, German, and Swiss borders. (See Part 138b).

To date I have not been able to find a birth registration, civil or parochial near 1869 for great-grandfather Eugène Brunhammer. We know he existed. We can follow his life from about when he left Dornach across the Atlantic Ocean, to Philadelphia and Gloucester City, to Ware in Massachusetts and then to where he finally settled in Wilmington, Delaware.

All-things-being-equal, and from the records obtained, Eugène was the second son of Jacques (aka Jacob) and Marie (aka Mary) (née Katz) Brunhammer, (possibility Bruhammer). Follow the key events of his life as I map them from about 1869 to 15 April 1930.

The first map, created in Ancestral Atlas, is a general overview plotted through the years from France to the United States. The green marker is the location of his birth, circa 1869 and the red marker is the location where he is recorded to have lived per the 1930 US Census.

The next map is an enlarged and more detailed map connecting Dornach to Le Havre. There is no evidence of the route the family took from Dornach and Mulhouse in the Alsace region to Le Havre, but we do have the Passenger Manifest from the Amérique which did sail from Havre. (See Part 92b.)

The calculated straight-line distance from Mulhouse to Le Havre is 351.7 miles or 566 Kilometers. This would have been the first leg of the journey, and this is not necessarily the actual distance traveled. The trip across the Atlantic Ocean would have approximated 3,600 miles, about 5,800 kms, and it may have been longer as the ship may have landed at Plymouth in England and at New York in the Unites States.

The third map is one that shows his actual journey arriving at the Port of Philadelphia, traveling to Gloucester City, New Jersey; Ware, Massachusetts; and Wilmington, Delaware.

The upper blue marker near Philadelphia represents the ship’s arrival at the Port on the 17th of May 1876. The family must have lived there for some period of time in and around Philadelphia about 1877 as that was the year that Brother, great-granduncle Harry, the first American Brunhammer is ascribed to have been born.

The lower blue marker, right between the texts of Philadelphia and Cherry Hill on the map, marks the 9 June 1880 US Census and the 1885 New Jersey State Census location of Gloucester City, New Jersey where the family spears to have settled. And as there is no 1890 US Census available, due to being destroyed in a fire, the next blue marker in the upper right-hand of the inserted map marks the location where great-grandfather Eugène lived in Ware, Massachusetts on the 18th of June 1900.

The next inserted image is a further enlargement of the map showing the Philadelphia, Gloucester City, and Wilmington markers.

By 22 April 1910, great-grandfather Eugène had already moved his family from Massachusetts to Delaware. From the 1910 US Census of Wilmington, in the County of New Castle, his youngest daughter, grandaunt Anne Cecelia is enumerated at 5 years old. From our records we know that she was born in Wilmington 8 December 1904. Therefore the trip and move from Ware must have occurred sometime between June of 1900 and December of 1904.

The last inserted map shows in detail the streets that great-grandfather Eugène lived on over the passing of 20 years, as recorded in the subsequent 1910, 1920, and 1930 US Censuses.

On the 22th of April, 1910 he lived at 1828 N. Union Street. On the 6th of January, 1920 he had moved nearby to 1807 Shallcross Avenue, and on the 15th of April 1930 he lived at 829 Van Buren Street. All three locations are about within one mile in Wilmington, near Brandywine Park.

I may have more data and paperwork relating to great-grandfather Eugène Brunhammer, but that’s the organization of paperwork that I now pre-maturely make as my first New Year’s resolution.

Enjoy, and Merry Christmas Brunhammers,

Jim

Click here to continue reading...

Part 146b – Brunhammer Doherty Genealogy – How Do You Spell Brunhammer?

Afternoon,

I'm now wearing new glasses...

Last night I discovered a couple more variations on the spelling of the surname Brunhammer. I found two unique transcriptions: "Brunleansen" and "Brunhamse" transcribed from the 1930 and 1920 US Censuses, respectively. These I located on Ancestry.com when I followed a search with a wild card “*”; that is, I keyed in the combination “Brun*”, with no first name. I also limited my search to Gloucester City, in Camden County, New Jersey.

The results were only 79 hits and included a "Thomas A Brunleansen", from the 1930 Census, and "Thomas Brunhamse", from the 1920. Both are the same person, based on the information provided in each Census. And the actual entries, regardless of how they were transcribed for Ancestry.com, the enumerators, from my eyes, entered: 1920 – “Brunhamer, Thomas”; and 1930 – “Brunhamer, Thomas A.”

Moving out of a fixed location search, and cross-checking with the 1910 Census from Philadelphia, Pennsylvania, Thomas’ surname is entered as “Brunhammer”. And here’s a wrench, and not necessarily a bad one; an alternative spelling for the 1910 surname is given as “Brunhemer”.

The 1900 Census of the South side of the Center of 8th Street, in Chester in the County of Delaware in Pennsylvania presents a unique researcher’s challenge. This time the enumerator appears, by my eyes, to have entered “Bernhemmer”. The transcriber entered the name as “Bernkenner” to Ancestry.com. Amazing…

And of course the burned up 1890 Census is no longer with us. But I was able to find an 1885 New Jersey State Census taken of the City of Gloucester in Camden County which includes the “Brunhammer” family plus Thomas. I discovered this page from a microfilm FHL [888604].

In 1883, the document of citizenship indicates that the surname is Brunhammer. See Part 96b. But gg-grandfather Jacob (aka Jacques) Brunhammer signed the document with his “X” mark. If he was illiterate, that could mean that he himself did not have an immediate idea of how to physically spell his surname. It appears that his witness, William C. Guy is the one who penned the “Brunhammer”.

Now the most puzzling of all spellings, or should I state “visual interpretation” is that of the 1880 Census. The penmanship of the enumerator is very good, in my opinion… and his written capital “B” looks like a capital “B”. And due to the fact that I am optically used to seeing the surname as Brunhammer, I can see the name written as “Brunhammer”. It may look a bit like “Brunharness”, but here’s the rub, accordingly, the clerk who transcribed surnames from the 1880 US Census to the Soundex Index Cards, eyeballed the name as “Preenharness”. It then appears that “Preenharness” was then transcribed and entered in the Ancestry.com database as such.

And then the 1876 Amérique Passenger Manifest lists the surname as “Bruhammer”, see Parts 92b and 138b. Just a note, of “eureka-ness”… for the lack of a better term; the 1920 and 1930 US Censuses list great-granduncle Thomas’ son as Camille. This now cross-references to the 1876 Passenger Manifest where there listed a 5-year old Camille who, all-things-being-equal, has to be the same person as Thomas. His name must have been Anglicized.

My discussion in Part 133b presents two distinctive writings of the surname: “Brunhammer” on the Table Décennales, the 10-Year Table; and what looks like “Brunhamer” in the 1837 Civil Registration of gg-grandfather Jacques’ birth.

And so to date, within this limited scope of study, I have discovered the surname written, transcribed and interpreted in a number of ways. This list is not all conclusive as I am extracting the surnames from only a few referenced documents applicable to gg-grandfather Jacques (aka Jacob) and his son, great-granduncle Thomas (aka Camille).

The spellings are -

1837 – Brunhamer
1842 – Brunhammer
1876 – Bruhammer
1880 – Brunhammer, Brunharness, Preenharness
1883 – Brunhammer
1885 – Brunhammer
1900 – Bernhemmer, Bernkemmer
1910 – Brunhammer, Brunhemer
1920 – Brunhamer, Brunhamse
1930 – Brunhamer, Brunleasen

Have fun with this one,

Jim
----------------------
Partie 146B - Brunhammer Doherty -- Comment épeler, Brunhammer?

Bonjour,

La nuit dernière, j'ai découvert, un couple plus de variations sur l'orthographe du nom de famille Brunhammer. J'ai trouvé deux transcriptions unique: «Brunleansen» et «Brunhamse», transcrits à partir des recensements des États-Unis des années 1930 et 1920, respectivement. Je les trouve sur Ancestry.com, lorsque j'ai suivi une recherche, avec une wild card, «*» ; qui est, je saisi à la combinaison «Brun*», sans prénom. J'ai aussi limité ma recherche à Gloucester City, dans le comté de Camden, New Jersey.

Les résultats ont été seulement 79 coups sûrs, et comprenait un «Thomas A Brunleansen», à partir du recensement de 1930, et «Thomas Brunhamse», à partir du 1920. Les deux sont la même personne, sur la base des informations fournies dans chaque recensement. Et les entrées elles-mêmes, indépendamment de la façon dont elles ont été transcrites pour Ancestry.com, les agents recenseurs, de mes yeux, est entré: 1920 - «Brunhamer, Thomas», et 1930 - «Brunhamer, Thomas A».

Déménagement d'une recherche de lieu fixe, et le recoupement avec les années 1910 Recensement de Philadelphie, en Pennsylvanie, le nom de Thomas est entré comme «Brunhammer». Et voici une clé, et pas nécessairement un mauvais; une orthographe de remplacement pour le nom de famille 1910 est considéré comme une «Brunhemer».

Le recensement de 1900 du côté Sud du Centre de la 8e Rue, à Chester, dans le comté de Delaware en Pennsylvanie, présente un défi unique pour ce chercheur. Cette fois, le recenseur paraît, par mes yeux, d'avoir saisi «Bernhemmer». Le transcripteur entré le nom de «Bernkenner» à Ancestry.com. Étonnante ...

Et bien sûr, le brûlé recensement de 1890, n'est plus avec nous. Mais j'ai été capable de trouver un État du New Jersey, Recensement de 1885, prise de la ville de Gloucester, dans le comté de Camden, qui comprend la famille des «Brunhammer» plus Thomas. J'ai découvert cette page à partir d'un microfilm FHL [888604].

En 1883, le document de citoyenneté indique que le nom de famille est Brunhammer. Voir la partie 96b. Mais gg-grand-père Jacob (Jacques) Brunhammer signé le document avec son "X». Si il était illettré, cela peut signifier que lui-même n'a pas eu l'idée immédiate, de l'orthographe physiquement son nom de famille. Il semble que son témoin, William C. Guy est celui qui a écrit le «Brunhammer».

Maintenant, le plus énigmatique de tous les orthographes, ou devrais-je dire «l'interprétation visuelle», est celle du recensement de 1880. La calligraphie de l'agent recenseur est très bonne, à mon avis ... et sa capitale écrite «B» ressemble à un capital «B». Et au fait, que je suis optiquement l'habitude de voir le nom de famille comme Brunhammer, je peux voir le nom écrit comme «Brunhammer». Elle mai ressembler un peu «Brunharness», mais voici la différence, en conséquence du greffier, qui transcrit à partir des noms de famille de recensement des États-Unis 1880 à nos fiches des Soundex, vu le nom de «Preenharness». Il apparaît alors que «Preenharness» a ensuite été transcrites, et est entré dans la base de Ancestry.com, en tant que telle.

Et puis le manifeste de passagers de 1876, du navire Amérique, ne mentionne le nom de famille comme «Bruhammer», voir les parties 92b et 138b. Juste une remarque, d'Eureka ... pour l'absence d'un meilleur terme, les 1920 et 1930 US recensements liste Camille, le fils du grand-grand-oncle Thomas. Ce maintenant traverser les références, au manifeste de passagers de 1876, où il a énuméré un à 5 ans, Camille, qui doit être la même personne que Thomas. Son nom doit avoir été faite en anglais.

Mon exposé dans la partie 133b, présente deux écrits distinctif du nom de famille: «Brunhammer» Tables décennales, et ce qui ressemble à «Brunhamer»" dans l'état civil de 1837 de la naissance du arrière- arrière-grand-père Jacques.

Et si à ce jour, dans ce cadre limité de l'étude, j'ai découvert le nom de famille écrit, transcrit, et interprété, dans un certain nombre de façons. Cette liste n'est pas concluante, car je suis l'extraction des noms de famille, à partir de seulement quelques documents référencés, applicable à l’arrière-arrière-grand-père Jacques (Jacob) et son fils, arrière-grand-oncle Thomas (Camille).

Les orthographes sont –

1837 – Brunhamer
1842 – Brunhammer
1876 – Bruhammer
1880 – Brunhammer, Brunharness, Preenharness
1883 – Brunhammer
1885 – Brunhammer
1900 – Bernhemmer, Bernkemmer
1910 – Brunhammer, Brunhemer
1920 – Brunhamer, Brunhamse
1930 – Brunhamer, Brunleasen

Amusez-vous avec celui-ci,

Jim

Click here to continue reading...

Part 122b – Brunhammer Genealogy – Y-DNA Results Are Back

Afternoon,
This morning I thought I would follow up with just a few numbers to boggle your mind… actually 67 numbers. Andy’s Y-DNA test results are all back, and before you sit down and put all 67 numbers to memory, I thought I would try and present a bit of info to help clarify what this all may mean. I first introduced the topic of Brunhammer Y-DNA in Part 83b.

The first thing to know is that there are two chromosome tests that Andy has had done; the Y-DNA and the mtDNA tests. I going to begin discuss a bit of my understanding of the Y-DNA testing and results in this posting.

Andy is still waiting for the mtDNA results which should be back sometime in December. My sources of information are FamilyTreeDNA, WorldFamlies, C. F. Kerchner & Associates, and Genetree.

This Y-DNA Chromosome test only traces the MALE line, that is, only the male Brunhammer line. In this case, Andy from his father Eugene; from his grandfather Harry; from his great-grandfather Eugène; from his great-great-grandfather Jacques (aka Jacob); from his ggg-grandfather Joseph; from his gggg-grandfather Sébastien; from his ggggg-grandfather Conrad; from his gggggg-grandfather Conradus, and back… Per the information, it also means that all of Andy’s brothers and uncles should realize the same Y-DNA results.

But it doesn’t only stop there. This means that all of Andy’s brothers’ sons should have the same results. That is, John, Steve, Paul, John, Eric, Todd, and Brandon all exhibit the same Y-DNA results, all 67-marker results. Remember this is specific to the male Brunhammer line only. Y-DNA was not passed to any of his sisters, or aunts, or his sister’s sons.

And this means that every one of great-great-grandparents Jacques and Marie (aka Jacob and Mary)’s sons’ sons’ and grandsons, and so on all should carry the same Y-DNA. Also all of the Brunhammer, Bruhammer, Brunhamer, and Bruhamer sons who can trace their descendency from gggggg-grandfather Conradus Bruhamer should show the same.

From our most recent contacts these Y-DNA results should include: Eric, Juju, Mark, Nicolas, Norman, Phyllip, Tom, Walter, Alan, Pierre, Mathieu et al.

The actual Y-DNA results are –

These are all 67 markers. The DYS# is the Designated Y chromosome Segment. It is the name for the marker at a particular location, place, or locus. In Andy’s case all 67 markers at the 67 locations were tested. The Allele is a DNA sequence that repeats at a certain location on the Y chromosome. As the Allele number for DYS# 393 is 13, this means that the code at this location is repeated 13 times. And if the code is GATA, then the Allele value would be GATA and GATA and GATA, for a total of 13 times. It would look like – GATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATA. This is what is used to compare to other men’s DNA at this DYS# 393 location. All this being equal, all the male descendants of Conradus Bruhamer should all match at all 67 markers.

I’ll stop here for right now, so you can digest this. The Brunhammer Haplogroup has been predicted at I2a, I-P37.2 for short… but I’ll continue that at another posting shortly.

Enjoy,

Jim.

Click here to continue reading...

Part 95b – Brunhammer Descendant Chart II

Afternoon,

As I mentioned I have split the Brunhammer descendant line into two Charts: I and II.

Chart I (Part 93b) begins with Andy and follows his paternal blood line through Chart II.

The lineage is as follows:

Andy

Father - Eugene John Brunhammer; b.1920, Delaware, USA; d.2001, Delaware, USA

Grandfather – Harry Emmet Anthony Brunhammer; b.1891, Delaware, USA; d.1959, Delaware, USA

Great-Grandfather – Eugène A. Brunhammer; b.c.1868, Dornach, France; d.?, Delaware, USA

GG-Grandfather – Jacques Brunhammer; b.1837, Dornach, France; d.c.1910, Pennsylvania, USA

GGG-Grandfather – Joseph Bruhamer; b.1806, Höchstädt, France; d.1874, Dornach, France

GGGG-Grandfather – Sébastien Brunhammer; b.1780, Höchstädt, France, d.1862, Dornach, France

GGGGG-Grandfather – Conrad Brunhammer; b.1746, Bad Säckingen, France; d.1809, Höchstädt, France

GGGGGG-Grandfather – Joannes Conradus Bruhamer; b.c.1704,? ; d.1776, Bad Säckingen, France

As you can see the surname Brunhammer is represented in a number of different ways and spellings. To date, and dependent upon the source and sources, we have found the following iterations: Brunhammer, Bruhammer, Brunhamer, Bruhamer, and even Preenharness.

Please note that as always, this family history search and research project is always under construction. Data and input can and may change based on the availability and source of documentation and information. If you have any questions please comment here in the Blog or feel free to contact me by email.

Stay tune for more.

Enjoy,

Jim

Click here to continue reading...

Part 85b – Brunhammer Haplogroup I2a & Origin

Good day,

Following up from my genealogical research and the Brunhammer family in Part 83b, we've been waiting, and waiting, and biting our nails to the quick. (Just a quick note… The label Part 85b in the title is my way of keeping track of my genealogical research in the Blog. In this case the "b" stands for Brunhammer.)

Andy's, the Brunhammer's predicted Haplogroup results came in this morning. It is I2a. That is, the letter "I"… not L… nor the number 1. Remember I2a. It's the first set of results, and predictions returned from the 12-Marker test.

The Human Y chromosome DNA (Y-DNA) haplogroups are lettered A through T. They are further subdivided using numbers and lower case letters. (These are established by the Y Chromosome Consortium.) You can read about it in much more detail on Wikipedia.

Source: Haplogroup I (Y-DNA)



On the inserted chart, you can see the position where Haplogroup I is located. Whereas the ancestry of I is widespread in Europe, I2 is more localized to Central and Southeast Europe and Sardinia.

Andy's Brunhammer Y-Haplotree, from Family Tree DNA is pictured on the right.

Predicted Haplogroup Y-Haplotree
Source: Family Tree DNA




You can incorporate the two Trees together at point I.




In the research, the Y-chromosomal "Adam" is the name given by researchers to the male who is the most recent patrilineal (male-lineage) ancestor of all humans. (See the top of the first inserted chart.)

Andy's, the Brunhammer's, migration map shows the origin of "Adam", the Y-Chromosome Adam, from 60,000 years ago. From the information provided, it should be noted that while he was not the only male living at the time, no other lineages remain today.

Haplogroup I Migration Map
Source: Family Tree DNA

Following the migration path from "Adam" you can see the travel out of Africa and into the Middle East. Based on a continued migration, the parent, (Haplogroup F), of most non-African branches was born, somewhere about 45,000 years ago. Then some 25,000 years ago Haplogroup I originated either in the Middle East or in Southern Europe. This was sometime during the last ice age when people took refuge along the Mediterranean. At the end of the ice age, members of the I2a branch spread north into Eastern Europe and west along the Mediterranean.

And here's where it becomes a waiting game…

Stay-tuned.

Jim

Click here to continue reading...

Part 83b - Brunhammer YDNA - Is It Bosnia Herzegovina? Scandinavia? Sardinia?

News Flash… Just in… 393=13… 390=24… 19=16… 391=11… 385a=13… 385b=15… 426=11… 388=12… 439=12… 389-1=13… 392=11… 389-2=31

Andy is waiting. The first results of his YDNA testing are back from Family Tree DNA. The first 12. Loci 1 through 12... and the scrolling DYS #s and the resulting Alleles. In other words, so far, the actual allele values for 12 locations, DYSs, on his Y chromosome.

Andy is waiting for his Haplogroup. Haplogroups are predicted based on 12-marker results. The Haplogroups are the major branches on the Y chromosome tree.

Fundamentally, a locus is a specific spot in the genome. The DYS is DNA Y-Chromosome Segment, the "name" of each marker.

The YDNA marker results are matched against other individuals who have had the testing done. There are 12-, 25-, 37- and 67-marker tests available. The more markers that match the great the probability that there is a Most Recent Common Ancestor (MRCA) shared with another person.

Andy is waiting for results... for a total of 67-markers.

Y chromosomes are passed from father to son, to son, to son, generation to generation. Andy's Y chromosomes were passed to him by his father Eugene John, which were passed to him by his father Harry Emmet Anthony, which were passed to him by his father Jacques aka Jacob, which were passed by his father Joseph... and so on, and so on, and so on, back to who we believe, Joannes Conradus Bruhamer of 1704.  (The big blue circle on the above inserted map is the location mentioned in the earliest document we have on file for Joannes Conradus.)

But what does this mean?

It means that all of the male descendants of Joannes Conradus Bruhamer should have the same Y-DNA results. It means that each of J, S, P, J, E, T, B, T, M, P, W, W, E, R, J, W, A, M, N, T, and plus, should have the same Y-DNA results as Andy. (Sorry ladies and sisters, just the males.)

Andy's immediate results also show five 12-Marker exact matches. These are matches to five other persons whose information and testing is with Family Tree DNA. But stay tuned... Keep checking at this Blog. We'll have updates as we hear.

Is it Bosnia Herzegovina? Scandinavia? Sardinia?

Regards,

Jim and Andy.
------------------------------------------------

S'il vous plaît excuser mon français.

Andy est en attente. Les premiers résultats de ses tests de YDNA sont de retour de Family Tree DNA. Les 12 premiers. Loci: 1 à 12 ... et les DYS# s au sommet, et les allèles qui en résulte. En d'autres termes, jusqu'à présent, les valeurs réelles des allèles pour 12 sites, DYSs, sur son chromosome Y.

Andy attend son haplogroupe. Haplogroupes sont prévus à partir du 12-marker résultats. Le Haplogroupes sont les principales branches de l'arbre chromosome Y.

Fondamentalement, un lieu est une place spécifique dans le génome. La DYS est le DNA du chromosome Y du segment, le «nom» de chaque marqueur.

Les résultats marqueur YDNA sont comparées avec d'autres individus qui ont eu le test terminé. Il ya 12 -, 25 -, 37 - and 67-marqueur de tests disponibles. Les marqueurs de plus qui correspondent à la probabilité que le grand qu'il existe un plus récent ancêtre commun (MRCA), commune à une autre personne.

Andy est en attente des résultats ... pour un total de 67 marqueurs.

Chromosomes Y sont transmis de père en fils, de fils, de fils, de génération en génération. Les chromosomes Y d'Andy, ont été transmis à lui par son père Eugène-Jean, qui ont été transmises à lui par son père Harry Emmet Anthony, qui ont été transmises à lui par son père, Jacques alias Jacob, qui ont été transmises par son père Joseph ... et ainsi de suite, et ainsi de suite, et ainsi de suite, de retour à ce que nous croyons Joannes Conradus Bruhamer de 1704. (Le cercle grande bleue, sur la carte ci-dessus inséré, est l'endroit indiqué, dans le premier document, nous avons le fichier, par Joannes Conradus.)

Mais qu'est-ce que cela signifie?

Cela signifie que tous les descendants mâles de Joannes Conradus Bruhamer devraient avoir le Y-résultats de DNA. Cela signifie que chacun des J, S, P, J, E, T, B, T, M, P, W, W, E, R, J, W, A, M, N, T, et en plus, devrait avoir Y mêmes résultats DNA comme Andy. (Désolé, les filles et soeurs, juste les hommes.)

Les résultats immédiats de Andy, montrent aussi cinq de 12 correspondances exactes Marker. Voici les résultats de cinq autres personnes, dont les informations et d'analyses avec Family Tree DNA. Mais restez à l'écoute ... Soyez à l'affût de ce blog. Nous aurons des mises à jour que nous entendons.

Est-il Bosnie-Herzégovine? Scandinavie? Sardaigne?

Bon chance,

Jim et Andy.

Click here to continue reading...